Incidental Mutation 'R0005:Nlrp9a'
ID63929
Institutional Source Beutler Lab
Gene Symbol Nlrp9a
Ensembl Gene ENSMUSG00000054102
Gene NameNLR family, pyrin domain containing 9A
SynonymsNalp9a, Nalp-theta, D7Ertd565e
MMRRC Submission 038301-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R0005 (G1)
Quality Score94
Status Validated
Chromosome7
Chromosomal Location26535023-26575615 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 26573788 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071780] [ENSMUST00000108387] [ENSMUST00000117252] [ENSMUST00000122040]
Predicted Effect probably benign
Transcript: ENSMUST00000071780
SMART Domains Protein: ENSMUSP00000071685
Gene: ENSMUSG00000054102

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 1e-32 PFAM
LRR 637 664 1.42e0 SMART
LRR 693 720 2.32e-1 SMART
LRR 722 749 3e0 SMART
LRR 750 777 1.12e-3 SMART
LRR 779 806 2.17e0 SMART
LRR 807 834 2.27e-4 SMART
LRR 836 863 2.02e2 SMART
LRR 864 891 6.24e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108387
SMART Domains Protein: ENSMUSP00000104024
Gene: ENSMUSG00000054102

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 7.7e-33 PFAM
LRR 631 658 1.42e0 SMART
LRR 692 719 1.42e0 SMART
LRR 748 775 2.32e-1 SMART
LRR 777 804 3e0 SMART
LRR 805 832 1.12e-3 SMART
LRR 834 861 2.17e0 SMART
LRR 862 889 2.27e-4 SMART
LRR 891 918 2.02e2 SMART
LRR 919 946 6.24e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117252
SMART Domains Protein: ENSMUSP00000112398
Gene: ENSMUSG00000054102

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 8.8e-34 PFAM
LRR 637 664 1.42e0 SMART
Blast:LRR 666 692 1e-5 BLAST
LRR 693 720 2.32e-1 SMART
LRR 722 749 3e0 SMART
LRR 750 777 1.12e-3 SMART
LRR 779 806 2.39e0 SMART
LRR 807 834 6.24e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122040
SMART Domains Protein: ENSMUSP00000113318
Gene: ENSMUSG00000054102

DomainStartEndE-ValueType
PYRIN 5 87 1.07e-25 SMART
Pfam:NACHT 143 311 1e-32 PFAM
LRR 637 664 1.42e0 SMART
LRR 693 720 2.32e-1 SMART
LRR 722 749 3e0 SMART
LRR 750 777 1.12e-3 SMART
LRR 779 806 2.17e0 SMART
LRR 807 834 2.27e-4 SMART
LRR 836 863 2.02e2 SMART
LRR 864 891 6.24e1 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2l A G 7: 126,498,274 F201L probably damaging Het
BC037034 T C 5: 138,262,654 probably null Het
Camsap3 T A 8: 3,604,288 F653I probably damaging Het
Col11a2 C T 17: 34,062,879 probably benign Het
Col27a1 A G 4: 63,225,400 T442A probably benign Het
Cpsf1 A G 15: 76,600,680 probably null Het
Enpp4 T C 17: 44,102,175 N156S probably benign Het
Fat3 T A 9: 15,962,866 N3485I probably damaging Het
Gabra2 C T 5: 70,973,436 V350I probably benign Het
Gm8909 G T 17: 36,162,192 probably benign Het
Hivep2 A G 10: 14,128,749 T364A probably damaging Het
Kif1b A T 4: 149,181,927 V402E probably damaging Het
Lamc3 A G 2: 31,922,428 D959G probably benign Het
Mag T A 7: 30,908,354 probably benign Het
Map3k1 A G 13: 111,755,704 F1006L probably benign Het
Mapre2 G A 18: 23,853,693 G54D probably damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myadm C T 7: 3,297,564 Q281* probably null Het
Mylk3 A T 8: 85,327,203 V625D possibly damaging Het
Olfr974 A G 9: 39,942,956 D232G probably benign Het
Plcz1 T A 6: 140,040,564 probably benign Het
Plekhg5 TCCCCC TCC 4: 152,112,651 probably benign Het
Plekhh2 A C 17: 84,586,433 D892A probably benign Het
Ppih A G 4: 119,318,601 probably benign Het
Pramef12 G T 4: 144,395,853 F40L probably damaging Het
Rtn4ip1 A T 10: 43,932,478 M84L probably benign Het
Slc35f4 G A 14: 49,322,486 probably benign Het
Spocd1 G T 4: 129,956,778 D866Y possibly damaging Het
Stxbp4 C T 11: 90,548,917 R365Q possibly damaging Het
Tmed4 C T 11: 6,271,781 R185H probably damaging Het
Tmem2 A G 19: 21,812,220 T595A probably damaging Het
Tnfsf9 T C 17: 57,107,236 V221A possibly damaging Het
Vsx2 C A 12: 84,570,241 P100Q possibly damaging Het
Wdr48 T A 9: 119,909,434 D53E probably benign Het
Zfp335 T A 2: 164,909,302 S115C possibly damaging Het
Zfp608 G A 18: 54,895,520 P1274S possibly damaging Het
Other mutations in Nlrp9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Nlrp9a APN 7 26557625 missense probably benign 0.22
IGL00895:Nlrp9a APN 7 26558678 missense probably benign
IGL01081:Nlrp9a APN 7 26558094 missense possibly damaging 0.51
IGL01148:Nlrp9a APN 7 26557581 missense probably damaging 1.00
IGL01368:Nlrp9a APN 7 26557874 missense probably damaging 1.00
IGL01914:Nlrp9a APN 7 26557264 missense probably benign 0.01
IGL01952:Nlrp9a APN 7 26558019 missense probably benign 0.01
IGL02245:Nlrp9a APN 7 26557893 missense probably benign 0.02
IGL02449:Nlrp9a APN 7 26564971 missense probably benign 0.00
IGL02702:Nlrp9a APN 7 26564956 missense possibly damaging 0.67
IGL02944:Nlrp9a APN 7 26558651 missense probably benign 0.28
IGL03183:Nlrp9a APN 7 26557457 missense probably damaging 1.00
R0007:Nlrp9a UTSW 7 26551090 intron probably benign
R0007:Nlrp9a UTSW 7 26551090 intron probably benign
R0013:Nlrp9a UTSW 7 26571225 splice site probably null
R0086:Nlrp9a UTSW 7 26558547 missense probably damaging 0.98
R0659:Nlrp9a UTSW 7 26557278 missense probably damaging 1.00
R1126:Nlrp9a UTSW 7 26560741 missense probably benign 0.12
R1500:Nlrp9a UTSW 7 26567891 missense probably benign 0.01
R1585:Nlrp9a UTSW 7 26558668 missense probably benign 0.41
R1594:Nlrp9a UTSW 7 26570507 nonsense probably null
R1968:Nlrp9a UTSW 7 26564941 missense probably benign 0.23
R1989:Nlrp9a UTSW 7 26573913 missense probably benign 0.24
R2057:Nlrp9a UTSW 7 26557362 missense possibly damaging 0.55
R2058:Nlrp9a UTSW 7 26557362 missense possibly damaging 0.55
R2059:Nlrp9a UTSW 7 26557362 missense possibly damaging 0.55
R2188:Nlrp9a UTSW 7 26564929 missense probably damaging 1.00
R2318:Nlrp9a UTSW 7 26573852 missense probably damaging 0.98
R3110:Nlrp9a UTSW 7 26557872 missense probably benign 0.08
R3112:Nlrp9a UTSW 7 26557872 missense probably benign 0.08
R3237:Nlrp9a UTSW 7 26571385 nonsense probably null
R3545:Nlrp9a UTSW 7 26557332 missense probably benign 0.03
R3805:Nlrp9a UTSW 7 26564852 nonsense probably null
R4005:Nlrp9a UTSW 7 26558550 missense probably benign 0.02
R4057:Nlrp9a UTSW 7 26570646 missense probably benign 0.00
R4529:Nlrp9a UTSW 7 26571407 missense probably damaging 1.00
R4756:Nlrp9a UTSW 7 26557441 missense probably damaging 1.00
R4908:Nlrp9a UTSW 7 26550944 missense probably damaging 1.00
R4972:Nlrp9a UTSW 7 26570539 missense probably damaging 1.00
R4992:Nlrp9a UTSW 7 26557386 missense probably benign 0.00
R5042:Nlrp9a UTSW 7 26571278 missense probably damaging 1.00
R5224:Nlrp9a UTSW 7 26557292 missense probably benign 0.43
R5449:Nlrp9a UTSW 7 26557829 missense probably benign 0.04
R5644:Nlrp9a UTSW 7 26558568 missense possibly damaging 0.51
R5734:Nlrp9a UTSW 7 26570640 missense probably damaging 1.00
R5905:Nlrp9a UTSW 7 26558337 missense probably benign 0.02
R5978:Nlrp9a UTSW 7 26557278 missense probably damaging 1.00
R6028:Nlrp9a UTSW 7 26558337 missense probably benign 0.02
R6066:Nlrp9a UTSW 7 26558085 missense probably benign 0.00
R6082:Nlrp9a UTSW 7 26567977 missense probably benign 0.41
R6171:Nlrp9a UTSW 7 26558763 missense possibly damaging 0.71
R6352:Nlrp9a UTSW 7 26557626 missense probably damaging 1.00
R6490:Nlrp9a UTSW 7 26550886 missense probably damaging 1.00
R6540:Nlrp9a UTSW 7 26557392 missense possibly damaging 0.88
R7039:Nlrp9a UTSW 7 26567942 missense probably benign 0.03
R7151:Nlrp9a UTSW 7 26557247 nonsense probably null
R7173:Nlrp9a UTSW 7 26558178 missense probably benign 0.00
R7214:Nlrp9a UTSW 7 26551038 missense probably damaging 0.98
R7226:Nlrp9a UTSW 7 26558724 missense probably benign 0.02
R7250:Nlrp9a UTSW 7 26558718 missense possibly damaging 0.78
R7293:Nlrp9a UTSW 7 26571269 missense probably damaging 1.00
R7492:Nlrp9a UTSW 7 26557656 missense probably damaging 0.99
R7586:Nlrp9a UTSW 7 26557296 missense possibly damaging 0.83
R7844:Nlrp9a UTSW 7 26562581 missense possibly damaging 0.82
R8073:Nlrp9a UTSW 7 26560835 missense probably damaging 0.98
R8136:Nlrp9a UTSW 7 26557253 missense probably benign 0.34
R8400:Nlrp9a UTSW 7 26565006 missense probably benign 0.02
R8415:Nlrp9a UTSW 7 26557500 missense probably benign
R8774:Nlrp9a UTSW 7 26558559 missense possibly damaging 0.95
R8774-TAIL:Nlrp9a UTSW 7 26558559 missense possibly damaging 0.95
R8882:Nlrp9a UTSW 7 26558278 nonsense probably null
Z1176:Nlrp9a UTSW 7 26558229 missense probably damaging 1.00
Z1177:Nlrp9a UTSW 7 26557456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTGAAAGAGTCACACTTCCTCTCC -3'
(R):5'- TGCTGTTCCATACCAGACGAACAC -3'

Sequencing Primer
(F):5'- gacatggctcagtgagtgaag -3'
(R):5'- AGACGAACACCCCTCTTTTC -3'
Posted On2013-07-30