Incidental Mutation 'R8301:Runx1'
ID 639293
Institutional Source Beutler Lab
Gene Symbol Runx1
Ensembl Gene ENSMUSG00000022952
Gene Name runt related transcription factor 1
Synonyms AML1, Pebp2a2, Cbfa2, runt domain, alpha subunit 2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8301 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 92601466-92826149 bp(-) (GRCm38)
Type of Mutation makesense
DNA Base Change (assembly) C to A at 92605656 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Stop codon to Leucine at position 466 (*466L)
Ref Sequence ENSEMBL: ENSMUSP00000023673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023673] [ENSMUST00000113956] [ENSMUST00000168195]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000023673
AA Change: *466L
SMART Domains Protein: ENSMUSP00000023673
Gene: ENSMUSG00000022952
AA Change: *466L

DomainStartEndE-ValueType
low complexity region 42 55 N/A INTRINSIC
Pfam:Runt 65 194 4.5e-75 PFAM
low complexity region 205 220 N/A INTRINSIC
PDB:1B8X|A 333 374 2e-7 PDB
Pfam:RunxI 375 465 1.5e-42 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113956
AA Change: *388L
SMART Domains Protein: ENSMUSP00000109589
Gene: ENSMUSG00000022952
AA Change: *388L

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
Pfam:Runt 48 182 3.1e-81 PFAM
low complexity region 270 283 N/A INTRINSIC
Pfam:RunxI 294 387 4.9e-43 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000168195
AA Change: *452L
SMART Domains Protein: ENSMUSP00000131079
Gene: ENSMUSG00000022952
AA Change: *452L

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
Pfam:Runt 48 182 4.7e-82 PFAM
low complexity region 191 206 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
Pfam:RunxI 358 451 6.4e-43 PFAM
Meta Mutation Damage Score 0.9211 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Core binding factor (CBF) is a heterodimeric transcription factor that binds to the core element of many enhancers and promoters. The protein encoded by this gene represents the alpha subunit of CBF and is thought to be involved in the development of normal hematopoiesis. Chromosomal translocations involving this gene are well-documented and have been associated with several types of leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations affect hematopoiesis, and in some cases result in defective angiogenesis and intraventricular hemorrhage. Null homozygotes die by embryonic day 12.5; heterozygotes have reduced erythroid and myeloid progenitor numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,972,505 I374F probably benign Het
9430076C15Rik A G 6: 53,681,033 D116G possibly damaging Het
Ak9 G A 10: 41,424,716 V1108I Het
Aldh16a1 C T 7: 45,141,982 A790T possibly damaging Het
Anks1 A T 17: 28,059,580 probably benign Het
Antxr2 T G 5: 97,977,679 T240P probably benign Het
Arfgef1 A T 1: 10,179,833 M945K probably damaging Het
Arhgef17 T C 7: 100,879,659 T1591A probably benign Het
Aurka A G 2: 172,356,930 S374P probably damaging Het
Bccip T C 7: 133,719,204 S236P probably benign Het
Cacna1s T A 1: 136,073,441 probably benign Het
Calm1 A G 12: 100,205,685 E132G probably benign Het
Casz1 A G 4: 148,946,043 D1173G probably damaging Het
Cdh17 A G 4: 11,795,659 D413G probably damaging Het
Cfap57 A G 4: 118,593,074 I617T possibly damaging Het
Csnka2ip A C 16: 64,478,991 S337A unknown Het
Ddx60 A G 8: 62,000,597 E1250G probably benign Het
Dlgap2 T A 8: 14,823,577 S727T probably benign Het
Dpy19l1 T C 9: 24,485,111 probably benign Het
Ebf2 A G 14: 67,238,982 T134A possibly damaging Het
Echdc2 A T 4: 108,172,909 M136L probably benign Het
Enpp2 A G 15: 54,851,407 F598S probably benign Het
Extl3 A C 14: 65,076,284 L483R probably damaging Het
Gcat T C 15: 79,035,889 V227A possibly damaging Het
Hsf2 A G 10: 57,505,346 D344G probably damaging Het
Ighm C T 12: 113,421,545 G265D Het
Igsf9b T G 9: 27,334,739 probably benign Het
Ints6 A G 14: 62,702,453 V596A probably benign Het
Ints8 T C 4: 11,246,120 E182G probably damaging Het
Iqgap2 A G 13: 95,682,151 probably null Het
Kalrn G T 16: 34,357,100 Q250K probably benign Het
Lrrc1 T A 9: 77,544,488 N46Y probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naa50 A G 16: 44,157,131 N74S probably benign Het
Neb T C 2: 52,288,835 N1303S probably benign Het
Nfs1 A T 2: 156,134,493 C160* probably null Het
Olfr472 A G 7: 107,903,626 K303R probably benign Het
Olfr591 T G 7: 103,173,073 K188T probably damaging Het
Olfr740 T A 14: 50,453,564 S171T probably benign Het
Olfr809 T C 10: 129,776,840 S309P probably benign Het
Orm2 T C 4: 63,363,026 F67S possibly damaging Het
Pex5 A G 6: 124,405,183 S180P probably benign Het
Phf14 G C 6: 11,992,062 G746R probably damaging Het
Pkm T A 9: 59,668,631 V110E probably damaging Het
Plekha6 T G 1: 133,264,687 N78K probably damaging Het
Plxna2 G A 1: 194,790,175 V1076I probably benign Het
Polq C A 16: 37,061,819 D1448E probably damaging Het
Pot1b T C 17: 55,687,895 T256A probably benign Het
Prkch C T 12: 73,702,764 T377I possibly damaging Het
Prl3c1 A C 13: 27,199,185 probably benign Het
Prl7b1 A C 13: 27,602,772 V158G possibly damaging Het
Prss22 T C 17: 23,993,981 S261G probably damaging Het
Psd T C 19: 46,321,102 probably benign Het
Psg18 A T 7: 18,353,377 Y119N probably damaging Het
Rbm6 T G 9: 107,852,794 R218S probably damaging Het
Rnf213 T A 11: 119,434,742 S1491T Het
Rsf1 T C 7: 97,661,925 S621P Het
Samd4 A G 14: 47,016,678 I200V probably benign Het
Sdsl C T 5: 120,459,519 C241Y probably benign Het
Sepn1 T C 4: 134,551,414 probably benign Het
Setx C T 2: 29,145,690 P729L possibly damaging Het
Sf1 C T 19: 6,368,366 Q55* probably null Het
Slc12a5 A T 2: 164,993,691 N833I probably damaging Het
Slc1a4 T C 11: 20,332,286 R63G probably damaging Het
Tmeff2 G T 1: 51,181,837 A324S probably benign Het
Tmem217 A G 17: 29,526,492 I88T possibly damaging Het
Tnfsf8 A T 4: 63,860,878 I61N probably benign Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trhde T A 10: 114,487,006 E667V probably benign Het
Unc13b A G 4: 43,263,568 T1598A probably benign Het
Vmn2r73 A T 7: 85,858,302 C601S probably benign Het
Zfp873 C A 10: 82,060,879 H481Q probably damaging Het
Other mutations in Runx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
Funyon UTSW 16 92605656 makesense probably null
G1Funyon:Runx1 UTSW 16 92605656 makesense probably null
PIT4382001:Runx1 UTSW 16 92613760 missense probably damaging 0.97
R0055:Runx1 UTSW 16 92644141 splice site probably benign
R0315:Runx1 UTSW 16 92605767 missense probably damaging 0.99
R1353:Runx1 UTSW 16 92689051 nonsense probably null
R4059:Runx1 UTSW 16 92644246 missense probably benign 0.09
R4771:Runx1 UTSW 16 92695741 missense possibly damaging 0.70
R4977:Runx1 UTSW 16 92644347 critical splice acceptor site probably null
R5631:Runx1 UTSW 16 92695563 missense possibly damaging 0.94
R6257:Runx1 UTSW 16 92695911 unclassified probably benign
R6435:Runx1 UTSW 16 92644295 missense possibly damaging 0.53
R9239:Runx1 UTSW 16 92606047 missense probably damaging 1.00
R9298:Runx1 UTSW 16 92644259 missense possibly damaging 0.71
R9389:Runx1 UTSW 16 92613680 missense possibly damaging 0.95
R9404:Runx1 UTSW 16 92689027 missense probably benign 0.04
Z1088:Runx1 UTSW 16 92605792 missense probably damaging 1.00
Z1176:Runx1 UTSW 16 92689101 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CGAAAACATTCCACACTCTTTGG -3'
(R):5'- TACCAGTTCTCCATGGTGGG -3'

Sequencing Primer
(F):5'- CACACTCTTTGGAATAAACAACGTGG -3'
(R):5'- TCTCCATGGTGGGCGGAG -3'
Posted On 2020-07-28