Incidental Mutation 'R8301:Tmem217'
ID 639295
Institutional Source Beutler Lab
Gene Symbol Tmem217
Ensembl Gene ENSMUSG00000079580
Gene Name transmembrane protein 217
Synonyms 4933413N12Rik, EG622644
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R8301 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 29526033-29549593 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 29526492 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 88 (I88T)
Ref Sequence ENSEMBL: ENSMUSP00000110331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114683] [ENSMUST00000168339]
AlphaFold Q14AF1
Predicted Effect possibly damaging
Transcript: ENSMUST00000114683
AA Change: I88T

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110331
Gene: ENSMUSG00000079580
AA Change: I88T

DomainStartEndE-ValueType
Pfam:DUF4534 11 168 6.8e-68 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168339
AA Change: I88T

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132463
Gene: ENSMUSG00000079580
AA Change: I88T

DomainStartEndE-ValueType
Pfam:DUF4534 11 168 5.3e-62 PFAM
Meta Mutation Damage Score 0.3014 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,972,505 I374F probably benign Het
9430076C15Rik A G 6: 53,681,033 D116G possibly damaging Het
Ak9 G A 10: 41,424,716 V1108I Het
Aldh16a1 C T 7: 45,141,982 A790T possibly damaging Het
Anks1 A T 17: 28,059,580 probably benign Het
Antxr2 T G 5: 97,977,679 T240P probably benign Het
Arfgef1 A T 1: 10,179,833 M945K probably damaging Het
Arhgef17 T C 7: 100,879,659 T1591A probably benign Het
Aurka A G 2: 172,356,930 S374P probably damaging Het
Bccip T C 7: 133,719,204 S236P probably benign Het
Cacna1s T A 1: 136,073,441 probably benign Het
Calm1 A G 12: 100,205,685 E132G probably benign Het
Casz1 A G 4: 148,946,043 D1173G probably damaging Het
Cdh17 A G 4: 11,795,659 D413G probably damaging Het
Cfap57 A G 4: 118,593,074 I617T possibly damaging Het
Csnka2ip A C 16: 64,478,991 S337A unknown Het
Ddx60 A G 8: 62,000,597 E1250G probably benign Het
Dlgap2 T A 8: 14,823,577 S727T probably benign Het
Dpy19l1 T C 9: 24,485,111 probably benign Het
Ebf2 A G 14: 67,238,982 T134A possibly damaging Het
Echdc2 A T 4: 108,172,909 M136L probably benign Het
Enpp2 A G 15: 54,851,407 F598S probably benign Het
Extl3 A C 14: 65,076,284 L483R probably damaging Het
Gcat T C 15: 79,035,889 V227A possibly damaging Het
Hsf2 A G 10: 57,505,346 D344G probably damaging Het
Ighm C T 12: 113,421,545 G265D Het
Igsf9b T G 9: 27,334,739 probably benign Het
Ints6 A G 14: 62,702,453 V596A probably benign Het
Ints8 T C 4: 11,246,120 E182G probably damaging Het
Iqgap2 A G 13: 95,682,151 probably null Het
Kalrn G T 16: 34,357,100 Q250K probably benign Het
Lrrc1 T A 9: 77,544,488 N46Y probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naa50 A G 16: 44,157,131 N74S probably benign Het
Neb T C 2: 52,288,835 N1303S probably benign Het
Nfs1 A T 2: 156,134,493 C160* probably null Het
Olfr472 A G 7: 107,903,626 K303R probably benign Het
Olfr591 T G 7: 103,173,073 K188T probably damaging Het
Olfr740 T A 14: 50,453,564 S171T probably benign Het
Olfr809 T C 10: 129,776,840 S309P probably benign Het
Orm2 T C 4: 63,363,026 F67S possibly damaging Het
Pex5 A G 6: 124,405,183 S180P probably benign Het
Phf14 G C 6: 11,992,062 G746R probably damaging Het
Pkm T A 9: 59,668,631 V110E probably damaging Het
Plekha6 T G 1: 133,264,687 N78K probably damaging Het
Plxna2 G A 1: 194,790,175 V1076I probably benign Het
Polq C A 16: 37,061,819 D1448E probably damaging Het
Pot1b T C 17: 55,687,895 T256A probably benign Het
Prkch C T 12: 73,702,764 T377I possibly damaging Het
Prl3c1 A C 13: 27,199,185 probably benign Het
Prl7b1 A C 13: 27,602,772 V158G possibly damaging Het
Prss22 T C 17: 23,993,981 S261G probably damaging Het
Psd T C 19: 46,321,102 probably benign Het
Psg18 A T 7: 18,353,377 Y119N probably damaging Het
Rbm6 T G 9: 107,852,794 R218S probably damaging Het
Rnf213 T A 11: 119,434,742 S1491T Het
Rsf1 T C 7: 97,661,925 S621P Het
Runx1 C A 16: 92,605,656 *466L probably null Het
Samd4 A G 14: 47,016,678 I200V probably benign Het
Sdsl C T 5: 120,459,519 C241Y probably benign Het
Sepn1 T C 4: 134,551,414 probably benign Het
Setx C T 2: 29,145,690 P729L possibly damaging Het
Sf1 C T 19: 6,368,366 Q55* probably null Het
Slc12a5 A T 2: 164,993,691 N833I probably damaging Het
Slc1a4 T C 11: 20,332,286 R63G probably damaging Het
Tmeff2 G T 1: 51,181,837 A324S probably benign Het
Tnfsf8 A T 4: 63,860,878 I61N probably benign Het
Tpbgl G T 7: 99,625,567 A361E probably damaging Het
Trhde T A 10: 114,487,006 E667V probably benign Het
Unc13b A G 4: 43,263,568 T1598A probably benign Het
Vmn2r73 A T 7: 85,858,302 C601S probably benign Het
Zfp873 C A 10: 82,060,879 H481Q probably damaging Het
Other mutations in Tmem217
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01094:Tmem217 APN 17 29526592 missense probably benign 0.13
IGL01695:Tmem217 APN 17 29526348 missense probably damaging 1.00
IGL02081:Tmem217 APN 17 29526373 missense probably damaging 1.00
IGL02704:Tmem217 APN 17 29526558 missense probably damaging 1.00
IGL02804:Tmem217 APN 17 29526481 missense probably damaging 1.00
G1Funyon:Tmem217 UTSW 17 29526492 missense possibly damaging 0.94
R0200:Tmem217 UTSW 17 29526310 missense probably benign 0.08
R0266:Tmem217 UTSW 17 29526599 missense possibly damaging 0.87
R0906:Tmem217 UTSW 17 29526516 missense probably damaging 1.00
R3111:Tmem217 UTSW 17 29526558 missense probably damaging 1.00
R3927:Tmem217 UTSW 17 29526703 missense probably damaging 1.00
R5628:Tmem217 UTSW 17 29526456 missense probably damaging 0.98
R5822:Tmem217 UTSW 17 29526555 missense probably damaging 1.00
R6766:Tmem217 UTSW 17 29526510 missense probably damaging 1.00
R9316:Tmem217 UTSW 17 29526409 missense probably benign 0.00
R9424:Tmem217 UTSW 17 29526716 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CGTGTGTGACAACAAAATATAGCC -3'
(R):5'- ATGGGCACAGTGTTGTCAGG -3'

Sequencing Primer
(F):5'- TGTGACAACAAAATATAGCCAGAAGC -3'
(R):5'- CATGCACCTCATCTTTGAAAGG -3'
Posted On 2020-07-28