Incidental Mutation 'R0005:Mag'
ID63930
Institutional Source Beutler Lab
Gene Symbol Mag
Ensembl Gene ENSMUSG00000036634
Gene Namemyelin-associated glycoprotein
SynonymsGma, siglec-4a
MMRRC Submission 038301-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0005 (G1)
Quality Score182
Status Validated
Chromosome7
Chromosomal Location30899176-30914873 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 30908354 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040548] [ENSMUST00000187137] [ENSMUST00000188569] [ENSMUST00000190638] [ENSMUST00000190950] [ENSMUST00000191081]
Predicted Effect probably benign
Transcript: ENSMUST00000040548
SMART Domains Protein: ENSMUSP00000041464
Gene: ENSMUSG00000036634

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 1.67e0 SMART
IG 144 237 4.38e0 SMART
IGc2 252 312 5.74e-13 SMART
IGc2 338 399 7.64e-9 SMART
transmembrane domain 511 533 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186422
Predicted Effect probably benign
Transcript: ENSMUST00000187137
SMART Domains Protein: ENSMUSP00000139564
Gene: ENSMUSG00000036634

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 1.67e0 SMART
IG 144 237 4.38e0 SMART
IGc2 252 312 5.74e-13 SMART
IGc2 338 399 7.64e-9 SMART
transmembrane domain 511 533 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188569
SMART Domains Protein: ENSMUSP00000140526
Gene: ENSMUSG00000036634

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 1.67e0 SMART
Blast:IG 152 195 1e-19 BLAST
IGc2 210 270 5.74e-13 SMART
IGc2 296 357 7.64e-9 SMART
transmembrane domain 469 491 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190638
SMART Domains Protein: ENSMUSP00000140578
Gene: ENSMUSG00000036634

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 6.7e-3 SMART
Blast:IG 144 168 5e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000190950
SMART Domains Protein: ENSMUSP00000139861
Gene: ENSMUSG00000036634

DomainStartEndE-ValueType
Blast:CLECT 1 64 3e-39 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000191081
SMART Domains Protein: ENSMUSP00000139881
Gene: ENSMUSG00000036634

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 135 6.7e-3 SMART
IG 144 237 1.8e-2 SMART
IGc2 252 312 2.4e-15 SMART
IGc2 338 399 3e-11 SMART
transmembrane domain 511 533 N/A INTRINSIC
low complexity region 577 591 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191486
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: This gene encodes a type I membrane protein and member of the immunoglobulin-like superfamily. It is expressed in myelinating glial cells, including oligodendrocytes of the central nervous system and Schwann cells of the peripheral nervous system. Mice lacking the encoded protein express abundant myelin, but suffer long-term axon degeneration, altered distribution of channels and adhesion molecules at nodes of Ranvier, and altered axon cytoskeletal structure. While not required for myelination, the encoded protein enhances axon-myelin stability, helps to structure nodes of Ranvier, and regulates the axon cytoskeleton. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit delayed CNS myelination, late myelin degeneration in peripheral nerves, hypomyelination of optic nerves, and subtle intention tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2l A G 7: 126,498,274 F201L probably damaging Het
BC037034 T C 5: 138,262,654 probably null Het
Camsap3 T A 8: 3,604,288 F653I probably damaging Het
Col11a2 C T 17: 34,062,879 probably benign Het
Col27a1 A G 4: 63,225,400 T442A probably benign Het
Cpsf1 A G 15: 76,600,680 probably null Het
Enpp4 T C 17: 44,102,175 N156S probably benign Het
Fat3 T A 9: 15,962,866 N3485I probably damaging Het
Gabra2 C T 5: 70,973,436 V350I probably benign Het
Gm8909 G T 17: 36,162,192 probably benign Het
Hivep2 A G 10: 14,128,749 T364A probably damaging Het
Kif1b A T 4: 149,181,927 V402E probably damaging Het
Lamc3 A G 2: 31,922,428 D959G probably benign Het
Map3k1 A G 13: 111,755,704 F1006L probably benign Het
Mapre2 G A 18: 23,853,693 G54D probably damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myadm C T 7: 3,297,564 Q281* probably null Het
Mylk3 A T 8: 85,327,203 V625D possibly damaging Het
Nlrp9a T C 7: 26,573,788 probably benign Het
Olfr974 A G 9: 39,942,956 D232G probably benign Het
Plcz1 T A 6: 140,040,564 probably benign Het
Plekhg5 TCCCCC TCC 4: 152,112,651 probably benign Het
Plekhh2 A C 17: 84,586,433 D892A probably benign Het
Ppih A G 4: 119,318,601 probably benign Het
Pramef12 G T 4: 144,395,853 F40L probably damaging Het
Rtn4ip1 A T 10: 43,932,478 M84L probably benign Het
Slc35f4 G A 14: 49,322,486 probably benign Het
Spocd1 G T 4: 129,956,778 D866Y possibly damaging Het
Stxbp4 C T 11: 90,548,917 R365Q possibly damaging Het
Tmed4 C T 11: 6,271,781 R185H probably damaging Het
Tmem2 A G 19: 21,812,220 T595A probably damaging Het
Tnfsf9 T C 17: 57,107,236 V221A possibly damaging Het
Vsx2 C A 12: 84,570,241 P100Q possibly damaging Het
Wdr48 T A 9: 119,909,434 D53E probably benign Het
Zfp335 T A 2: 164,909,302 S115C possibly damaging Het
Zfp608 G A 18: 54,895,520 P1274S possibly damaging Het
Other mutations in Mag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:Mag APN 7 30900387 missense probably benign 0.00
IGL02036:Mag APN 7 30908452 missense probably damaging 0.97
IGL03263:Mag APN 7 30899528 unclassified probably null
regie UTSW 7 30900729 missense probably damaging 0.98
R0403:Mag UTSW 7 30906980 missense probably damaging 1.00
R1590:Mag UTSW 7 30901852 missense probably damaging 0.99
R1874:Mag UTSW 7 30909051 missense probably benign 0.13
R2170:Mag UTSW 7 30908987 nonsense probably null
R2192:Mag UTSW 7 30900641 nonsense probably null
R3176:Mag UTSW 7 30901648 critical splice donor site probably null
R3177:Mag UTSW 7 30901648 critical splice donor site probably null
R3276:Mag UTSW 7 30901648 critical splice donor site probably null
R3277:Mag UTSW 7 30901648 critical splice donor site probably null
R4540:Mag UTSW 7 30900729 missense probably damaging 0.98
R4635:Mag UTSW 7 30906923 missense probably damaging 1.00
R4704:Mag UTSW 7 30909173 missense probably damaging 1.00
R4891:Mag UTSW 7 30900368 missense probably benign 0.04
R4940:Mag UTSW 7 30909200 missense probably damaging 1.00
R4952:Mag UTSW 7 30909156 nonsense probably null
R6301:Mag UTSW 7 30900679 missense probably damaging 1.00
R6441:Mag UTSW 7 30907083 missense possibly damaging 0.65
R6951:Mag UTSW 7 30911433 missense possibly damaging 0.89
R7562:Mag UTSW 7 30909134 missense possibly damaging 0.83
X0024:Mag UTSW 7 30907071 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTTAAGGGTCGTGCTCTGATAGC -3'
(R):5'- TGGCGCAGTCCAGGATTTGATG -3'

Sequencing Primer
(F):5'- AGCATCTTTCTCCTATTACAGCCAG -3'
(R):5'- AGTCCAGGATTTGATGCACCC -3'
Posted On2013-07-30