Incidental Mutation 'R8303:Zfp422'
ID639316
Institutional Source Beutler Lab
Gene Symbol Zfp422
Ensembl Gene ENSMUSG00000059878
Gene Namezinc finger protein 422
SynonymsKrox26, 2900028O21Rik, Krox-26, Krox25, KOX15, Krox-25-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8303 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location116624016-116628999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116626651 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 129 (H129L)
Ref Sequence ENSEMBL: ENSMUSP00000084926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057540] [ENSMUST00000079749] [ENSMUST00000112880]
Predicted Effect probably damaging
Transcript: ENSMUST00000057540
AA Change: H129L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084926
Gene: ENSMUSG00000059878
AA Change: H129L

DomainStartEndE-ValueType
ZnF_C2H2 55 77 6.32e-3 SMART
ZnF_C2H2 83 105 6.32e-3 SMART
ZnF_C2H2 111 133 1.06e-4 SMART
ZnF_C2H2 139 161 2.53e-2 SMART
ZnF_C2H2 167 189 2.12e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079749
AA Change: H129L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078685
Gene: ENSMUSG00000059878
AA Change: H129L

DomainStartEndE-ValueType
ZnF_C2H2 55 77 6.32e-3 SMART
ZnF_C2H2 83 105 6.32e-3 SMART
ZnF_C2H2 111 133 1.06e-4 SMART
ZnF_C2H2 139 161 2.53e-2 SMART
ZnF_C2H2 167 189 2.12e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112880
AA Change: H129L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108501
Gene: ENSMUSG00000059878
AA Change: H129L

DomainStartEndE-ValueType
ZnF_C2H2 55 77 6.32e-3 SMART
ZnF_C2H2 83 105 6.32e-3 SMART
ZnF_C2H2 111 133 1.06e-4 SMART
ZnF_C2H2 139 161 2.53e-2 SMART
ZnF_C2H2 167 189 2.12e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a putative C2H2 zinc finger transcription factor that may play a role in tooth development. A pseudogene related to this gene is located on chromosome 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,721 E114G probably benign Het
2810021J22Rik T A 11: 58,880,140 D149E probably benign Het
Aars2 T C 17: 45,507,597 C103R probably damaging Het
Aass T C 6: 23,092,368 D591G probably benign Het
Arhgap32 A G 9: 32,260,909 T1662A probably benign Het
Arhgap42 A T 9: 9,009,326 I520N probably damaging Het
Arhgef3 T C 14: 27,394,138 I279T probably damaging Het
Arid4b A G 13: 14,120,223 K30R probably damaging Het
Asxl3 C T 18: 22,524,416 R1828W probably benign Het
Bid T C 6: 120,900,239 Y47C probably benign Het
Card6 T C 15: 5,105,365 T119A probably benign Het
Cbr1 T C 16: 93,610,017 I207T probably damaging Het
Cep135 T C 5: 76,611,728 L443P probably damaging Het
Cfap43 T A 19: 47,765,835 R1017* probably null Het
Cfap52 T A 11: 67,939,795 S280C probably benign Het
Cntnap5b T C 1: 100,141,297 F81L probably damaging Het
Cyp4a12a A G 4: 115,328,933 D430G probably damaging Het
Cyp4f37 G A 17: 32,634,178 probably null Het
Dclre1a A G 19: 56,542,689 S742P probably damaging Het
Ddx54 T C 5: 120,621,790 F414S probably damaging Het
Dsp A G 13: 38,197,343 N2688S probably benign Het
Elovl4 A T 9: 83,788,267 probably null Het
Erbin A C 13: 103,830,186 probably null Het
Fsip2 A G 2: 82,988,380 D4819G probably benign Het
Gapvd1 G A 2: 34,712,200 P645L probably damaging Het
Gbp9 T C 5: 105,081,305 E492G possibly damaging Het
Gpc5 T A 14: 115,428,255 I497K probably benign Het
Hlx A G 1: 184,727,708 L411P probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ice1 A T 13: 70,606,407 I520N probably benign Het
Ist1 T C 8: 109,683,780 probably null Het
Itga3 T C 11: 95,062,640 D292G probably benign Het
Kif21a T C 15: 90,971,196 N655S probably damaging Het
Lrrtm1 A G 6: 77,244,679 H373R probably benign Het
Ngdn A T 14: 55,023,145 H270L probably benign Het
Nol4 G A 18: 23,040,174 probably benign Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr26 A C 9: 38,855,541 T160P probably damaging Het
Olfr347 A G 2: 36,734,455 I45V probably damaging Het
Olfr948 A C 9: 39,319,393 S74A probably damaging Het
Pask C A 1: 93,320,564 R1005L probably benign Het
Pcm1 A G 8: 41,283,721 T875A probably damaging Het
Pdrg1 A T 2: 153,009,667 I130N probably damaging Het
Plec A T 15: 76,189,266 M448K unknown Het
R3hdml T G 2: 163,499,912 V204G probably damaging Het
Rasa4 G A 5: 136,089,381 V32M possibly damaging Het
Scaf8 T C 17: 3,148,552 V44A unknown Het
Smad3 G T 9: 63,667,478 P177T probably benign Het
Smpd4 T A 16: 17,639,331 F384L probably damaging Het
Sycp2l G C 13: 41,129,799 L170F probably damaging Het
Tas2r107 T C 6: 131,659,622 S155G probably benign Het
Tmem143 T A 7: 45,916,570 M439K probably benign Het
Ttc41 A T 10: 86,719,630 T317S probably benign Het
Umps A G 16: 33,963,870 V71A possibly damaging Het
Usp17lc G A 7: 103,418,182 G228D possibly damaging Het
Usp17ld C T 7: 103,250,816 C303Y probably damaging Het
Vmn2r65 C A 7: 84,940,183 E842* probably null Het
Vmn2r94 A G 17: 18,244,171 F619S probably damaging Het
Vps13a T C 19: 16,616,906 T3154A probably benign Het
Vps13b C T 15: 35,639,917 T1311I probably damaging Het
Wdr66 T A 5: 123,322,587 V1204E probably damaging Het
Xpot A T 10: 121,611,500 Y353* probably null Het
Zfp319 A T 8: 95,329,137 L146Q probably damaging Het
Zzef1 T C 11: 72,917,189 F2709L probably damaging Het
Other mutations in Zfp422
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Zfp422 APN 6 116626958 missense probably benign 0.00
IGL00659:Zfp422 APN 6 116626505 nonsense probably null
IGL03199:Zfp422 APN 6 116626951 missense probably benign 0.43
R0190:Zfp422 UTSW 6 116626611 missense probably damaging 1.00
R1572:Zfp422 UTSW 6 116626784 missense probably damaging 1.00
R1756:Zfp422 UTSW 6 116626424 missense probably benign 0.00
R2290:Zfp422 UTSW 6 116626642 missense possibly damaging 0.74
R3724:Zfp422 UTSW 6 116626379 missense probably benign 0.00
R3932:Zfp422 UTSW 6 116626459 missense probably benign 0.00
R3933:Zfp422 UTSW 6 116626459 missense probably benign 0.00
R4700:Zfp422 UTSW 6 116626883 missense possibly damaging 0.59
R4806:Zfp422 UTSW 6 116626662 missense probably damaging 1.00
R4957:Zfp422 UTSW 6 116626943 nonsense probably null
R5784:Zfp422 UTSW 6 116626810 missense probably damaging 1.00
R6361:Zfp422 UTSW 6 116626820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCATGTGCTGCCTCAGATG -3'
(R):5'- CCTTACAAGTGTGCTAAATGCTCC -3'

Sequencing Primer
(F):5'- TGCCTCAGATGGGAGCTCTG -3'
(R):5'- TGCTCCAAGAGTTTCAGTCAGAGC -3'
Posted On2020-07-28