Incidental Mutation 'R8303:Olfr26'
ID639328
Institutional Source Beutler Lab
Gene Symbol Olfr26
Ensembl Gene ENSMUSG00000047667
Gene Nameolfactory receptor 26
SynonymsMTPCR09, MOR171-9, GA_x6K02T2PVTD-32550930-32551856
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R8303 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location38855060-38855990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 38855541 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 160 (T160P)
Ref Sequence ENSEMBL: ENSMUSP00000100467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104874]
Predicted Effect probably damaging
Transcript: ENSMUST00000104874
AA Change: T160P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100467
Gene: ENSMUSG00000047667
AA Change: T160P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.8e-49 PFAM
Pfam:7tm_1 41 290 2.4e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,721 E114G probably benign Het
2810021J22Rik T A 11: 58,880,140 D149E probably benign Het
Aars2 T C 17: 45,507,597 C103R probably damaging Het
Aass T C 6: 23,092,368 D591G probably benign Het
Arhgap32 A G 9: 32,260,909 T1662A probably benign Het
Arhgap42 A T 9: 9,009,326 I520N probably damaging Het
Arhgef3 T C 14: 27,394,138 I279T probably damaging Het
Arid4b A G 13: 14,120,223 K30R probably damaging Het
Asxl3 C T 18: 22,524,416 R1828W probably benign Het
Bid T C 6: 120,900,239 Y47C probably benign Het
Card6 T C 15: 5,105,365 T119A probably benign Het
Cbr1 T C 16: 93,610,017 I207T probably damaging Het
Cep135 T C 5: 76,611,728 L443P probably damaging Het
Cfap43 T A 19: 47,765,835 R1017* probably null Het
Cfap52 T A 11: 67,939,795 S280C probably benign Het
Cntnap5b T C 1: 100,141,297 F81L probably damaging Het
Cyp4a12a A G 4: 115,328,933 D430G probably damaging Het
Cyp4f37 G A 17: 32,634,178 probably null Het
Dclre1a A G 19: 56,542,689 S742P probably damaging Het
Ddx54 T C 5: 120,621,790 F414S probably damaging Het
Dsp A G 13: 38,197,343 N2688S probably benign Het
Elovl4 A T 9: 83,788,267 probably null Het
Erbin A C 13: 103,830,186 probably null Het
Fsip2 A G 2: 82,988,380 D4819G probably benign Het
Gapvd1 G A 2: 34,712,200 P645L probably damaging Het
Gbp9 T C 5: 105,081,305 E492G possibly damaging Het
Gpc5 T A 14: 115,428,255 I497K probably benign Het
Hlx A G 1: 184,727,708 L411P probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ice1 A T 13: 70,606,407 I520N probably benign Het
Ist1 T C 8: 109,683,780 probably null Het
Itga3 T C 11: 95,062,640 D292G probably benign Het
Kif21a T C 15: 90,971,196 N655S probably damaging Het
Lrrtm1 A G 6: 77,244,679 H373R probably benign Het
Ngdn A T 14: 55,023,145 H270L probably benign Het
Nol4 G A 18: 23,040,174 probably benign Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr347 A G 2: 36,734,455 I45V probably damaging Het
Olfr948 A C 9: 39,319,393 S74A probably damaging Het
Pask C A 1: 93,320,564 R1005L probably benign Het
Pcm1 A G 8: 41,283,721 T875A probably damaging Het
Pdrg1 A T 2: 153,009,667 I130N probably damaging Het
Plec A T 15: 76,189,266 M448K unknown Het
R3hdml T G 2: 163,499,912 V204G probably damaging Het
Rasa4 G A 5: 136,089,381 V32M possibly damaging Het
Scaf8 T C 17: 3,148,552 V44A unknown Het
Smad3 G T 9: 63,667,478 P177T probably benign Het
Smpd4 T A 16: 17,639,331 F384L probably damaging Het
Sycp2l G C 13: 41,129,799 L170F probably damaging Het
Tas2r107 T C 6: 131,659,622 S155G probably benign Het
Tmem143 T A 7: 45,916,570 M439K probably benign Het
Ttc41 A T 10: 86,719,630 T317S probably benign Het
Umps A G 16: 33,963,870 V71A possibly damaging Het
Usp17lc G A 7: 103,418,182 G228D possibly damaging Het
Usp17ld C T 7: 103,250,816 C303Y probably damaging Het
Vmn2r65 C A 7: 84,940,183 E842* probably null Het
Vmn2r94 A G 17: 18,244,171 F619S probably damaging Het
Vps13a T C 19: 16,616,906 T3154A probably benign Het
Vps13b C T 15: 35,639,917 T1311I probably damaging Het
Wdr66 T A 5: 123,322,587 V1204E probably damaging Het
Xpot A T 10: 121,611,500 Y353* probably null Het
Zfp319 A T 8: 95,329,137 L146Q probably damaging Het
Zfp422 T A 6: 116,626,651 H129L probably damaging Het
Zzef1 T C 11: 72,917,189 F2709L probably damaging Het
Other mutations in Olfr26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Olfr26 APN 9 38855799 missense probably benign 0.00
IGL01909:Olfr26 APN 9 38855717 nonsense probably null
IGL02146:Olfr26 APN 9 38855358 missense probably benign 0.01
IGL02229:Olfr26 APN 9 38855416 missense possibly damaging 0.62
IGL02382:Olfr26 APN 9 38855068 missense probably benign
IGL03007:Olfr26 APN 9 38855296 missense probably damaging 1.00
IGL03118:Olfr26 APN 9 38855230 missense probably damaging 1.00
PIT4403001:Olfr26 UTSW 9 38855380 missense probably benign 0.39
R0590:Olfr26 UTSW 9 38855470 missense probably damaging 0.99
R0862:Olfr26 UTSW 9 38855182 missense possibly damaging 0.89
R1779:Olfr26 UTSW 9 38855550 missense possibly damaging 0.55
R1796:Olfr26 UTSW 9 38855524 missense probably benign 0.01
R2083:Olfr26 UTSW 9 38855341 missense probably benign 0.10
R3420:Olfr26 UTSW 9 38855325 missense possibly damaging 0.92
R3421:Olfr26 UTSW 9 38855325 missense possibly damaging 0.92
R4328:Olfr26 UTSW 9 38855836 missense possibly damaging 0.62
R4470:Olfr26 UTSW 9 38855631 missense probably damaging 1.00
R4471:Olfr26 UTSW 9 38855631 missense probably damaging 1.00
R5047:Olfr26 UTSW 9 38855289 missense probably benign 0.36
R5267:Olfr26 UTSW 9 38855805 missense probably damaging 1.00
R5318:Olfr26 UTSW 9 38855448 missense probably damaging 1.00
R6502:Olfr26 UTSW 9 38855637 missense probably damaging 0.99
R7221:Olfr26 UTSW 9 38855242 missense probably damaging 1.00
R7297:Olfr26 UTSW 9 38855949 missense probably damaging 1.00
R7448:Olfr26 UTSW 9 38855116 missense probably damaging 1.00
R7525:Olfr26 UTSW 9 38855238 missense possibly damaging 0.89
R8040:Olfr26 UTSW 9 38855164 missense probably damaging 0.99
Z1177:Olfr26 UTSW 9 38855235 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTACTCAGAGTGCATGGCC -3'
(R):5'- CTTGATGTGAAGGATGCTGC -3'

Sequencing Primer
(F):5'- AGAGTGCATGGCCCAGCTC -3'
(R):5'- CTTGATGTGAAGGATGCTGCAGAAG -3'
Posted On2020-07-28