Incidental Mutation 'R8303:Cfap52'
ID639336
Institutional Source Beutler Lab
Gene Symbol Cfap52
Ensembl Gene ENSMUSG00000020904
Gene Namecilia and flagella associated protein 52
Synonyms4933417B11Rik, Wdr16, 1700019F09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.814) question?
Stock #R8303 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location67924806-67965651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67939795 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 280 (S280C)
Ref Sequence ENSEMBL: ENSMUSP00000021287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021287] [ENSMUST00000126766]
Predicted Effect probably benign
Transcript: ENSMUST00000021287
AA Change: S280C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021287
Gene: ENSMUSG00000020904
AA Change: S280C

DomainStartEndE-ValueType
WD40 53 97 3.71e-1 SMART
WD40 100 141 3.45e-3 SMART
WD40 149 186 1.03e1 SMART
low complexity region 262 273 N/A INTRINSIC
WD40 280 318 9.86e1 SMART
WD40 321 360 6.6e1 SMART
WD40 363 402 8.56e0 SMART
WD40 405 445 2.27e-3 SMART
WD40 450 489 3.14e-6 SMART
WD40 492 530 9.21e0 SMART
WD40 533 573 6.19e-5 SMART
WD40 576 615 2.15e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126766
AA Change: S280C

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000116496
Gene: ENSMUSG00000020904
AA Change: S280C

DomainStartEndE-ValueType
WD40 53 97 3.71e-1 SMART
WD40 100 141 3.45e-3 SMART
WD40 149 186 1.03e1 SMART
Blast:WD40 190 233 4e-12 BLAST
low complexity region 262 273 N/A INTRINSIC
WD40 280 318 9.86e1 SMART
Blast:WD40 321 342 1e-6 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WD repeat-containing proteins, such as WDR16, play crucial roles in a wide range of physiologic functions, including signal transduction, RNA processing, remodeling the cytoskeleton, regulation of vesicular traffic, and cell division (Silva et al., 2005 [PubMed 15967112]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,721 E114G probably benign Het
2810021J22Rik T A 11: 58,880,140 D149E probably benign Het
Aars2 T C 17: 45,507,597 C103R probably damaging Het
Aass T C 6: 23,092,368 D591G probably benign Het
Arhgap32 A G 9: 32,260,909 T1662A probably benign Het
Arhgap42 A T 9: 9,009,326 I520N probably damaging Het
Arhgef3 T C 14: 27,394,138 I279T probably damaging Het
Arid4b A G 13: 14,120,223 K30R probably damaging Het
Asxl3 C T 18: 22,524,416 R1828W probably benign Het
Bid T C 6: 120,900,239 Y47C probably benign Het
Card6 T C 15: 5,105,365 T119A probably benign Het
Cbr1 T C 16: 93,610,017 I207T probably damaging Het
Cep135 T C 5: 76,611,728 L443P probably damaging Het
Cfap43 T A 19: 47,765,835 R1017* probably null Het
Cntnap5b T C 1: 100,141,297 F81L probably damaging Het
Cyp4a12a A G 4: 115,328,933 D430G probably damaging Het
Cyp4f37 G A 17: 32,634,178 probably null Het
Dclre1a A G 19: 56,542,689 S742P probably damaging Het
Ddx54 T C 5: 120,621,790 F414S probably damaging Het
Dsp A G 13: 38,197,343 N2688S probably benign Het
Elovl4 A T 9: 83,788,267 probably null Het
Erbin A C 13: 103,830,186 probably null Het
Fsip2 A G 2: 82,988,380 D4819G probably benign Het
Gapvd1 G A 2: 34,712,200 P645L probably damaging Het
Gbp9 T C 5: 105,081,305 E492G possibly damaging Het
Gpc5 T A 14: 115,428,255 I497K probably benign Het
Hlx A G 1: 184,727,708 L411P probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ice1 A T 13: 70,606,407 I520N probably benign Het
Ist1 T C 8: 109,683,780 probably null Het
Itga3 T C 11: 95,062,640 D292G probably benign Het
Kif21a T C 15: 90,971,196 N655S probably damaging Het
Lrrtm1 A G 6: 77,244,679 H373R probably benign Het
Ngdn A T 14: 55,023,145 H270L probably benign Het
Nol4 G A 18: 23,040,174 probably benign Het
Nxpe5 G A 5: 138,241,002 probably benign Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr26 A C 9: 38,855,541 T160P probably damaging Het
Olfr347 A G 2: 36,734,455 I45V probably damaging Het
Olfr948 A C 9: 39,319,393 S74A probably damaging Het
Pask C A 1: 93,320,564 R1005L probably benign Het
Pcm1 A G 8: 41,283,721 T875A probably damaging Het
Pdrg1 A T 2: 153,009,667 I130N probably damaging Het
Plec A T 15: 76,189,266 M448K unknown Het
R3hdml T G 2: 163,499,912 V204G probably damaging Het
Rasa4 G A 5: 136,089,381 V32M possibly damaging Het
Scaf8 T C 17: 3,148,552 V44A unknown Het
Smad3 G T 9: 63,667,478 P177T probably benign Het
Smpd4 T A 16: 17,639,331 F384L probably damaging Het
Sycp2l G C 13: 41,129,799 L170F probably damaging Het
Tas2r107 T C 6: 131,659,622 S155G probably benign Het
Tmem143 T A 7: 45,916,570 M439K probably benign Het
Ttc41 A T 10: 86,719,630 T317S probably benign Het
Umps A G 16: 33,963,870 V71A possibly damaging Het
Usp17lc G A 7: 103,418,182 G228D possibly damaging Het
Usp17ld C T 7: 103,250,816 C303Y probably damaging Het
Vmn2r65 C A 7: 84,940,183 E842* probably null Het
Vmn2r94 A G 17: 18,244,171 F619S probably damaging Het
Vps13a T C 19: 16,616,906 T3154A probably benign Het
Vps13b C T 15: 35,639,917 T1311I probably damaging Het
Wdr66 T A 5: 123,322,587 V1204E probably damaging Het
Xpot A T 10: 121,611,500 Y353* probably null Het
Zfp319 A T 8: 95,329,137 L146Q probably damaging Het
Zfp422 T A 6: 116,626,651 H129L probably damaging Het
Zzef1 T C 11: 72,917,189 F2709L probably damaging Het
Other mutations in Cfap52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:Cfap52 APN 11 67953580 missense possibly damaging 0.67
IGL02034:Cfap52 APN 11 67946292 splice site probably null
IGL02530:Cfap52 APN 11 67954181 splice site probably benign
IGL02558:Cfap52 APN 11 67954138 missense probably benign 0.31
IGL02873:Cfap52 APN 11 67931782 missense probably damaging 1.00
IGL02887:Cfap52 APN 11 67953515 missense probably damaging 1.00
IGL02956:Cfap52 APN 11 67954075 missense probably benign
IGL03068:Cfap52 APN 11 67935856 missense probably benign 0.11
IGL03216:Cfap52 APN 11 67954106 missense possibly damaging 0.81
IGL03287:Cfap52 APN 11 67935976 unclassified probably benign
IGL03370:Cfap52 APN 11 67939055 missense probably damaging 0.98
chewbacca UTSW 11 67925125 missense possibly damaging 0.95
R0103:Cfap52 UTSW 11 67925125 missense possibly damaging 0.95
R0103:Cfap52 UTSW 11 67925125 missense possibly damaging 0.95
R0244:Cfap52 UTSW 11 67926382 missense possibly damaging 0.90
R0306:Cfap52 UTSW 11 67954070 missense probably benign
R0364:Cfap52 UTSW 11 67953610 missense possibly damaging 0.80
R0440:Cfap52 UTSW 11 67954088 missense probably benign
R0565:Cfap52 UTSW 11 67949599 missense probably benign 0.00
R1068:Cfap52 UTSW 11 67939004 missense probably benign 0.10
R1082:Cfap52 UTSW 11 67925172 missense probably damaging 0.99
R1509:Cfap52 UTSW 11 67938993 missense probably benign 0.00
R1894:Cfap52 UTSW 11 67953619 critical splice acceptor site probably null
R2994:Cfap52 UTSW 11 67939791 missense probably benign
R3954:Cfap52 UTSW 11 67930865 missense probably benign
R4611:Cfap52 UTSW 11 67926421 missense probably damaging 0.99
R4922:Cfap52 UTSW 11 67931722 critical splice donor site probably null
R5624:Cfap52 UTSW 11 67927358 missense possibly damaging 0.92
R5762:Cfap52 UTSW 11 67954121 missense possibly damaging 0.71
R5970:Cfap52 UTSW 11 67930744 missense probably damaging 1.00
R6037:Cfap52 UTSW 11 67946300 missense probably benign 0.00
R6037:Cfap52 UTSW 11 67946300 missense probably benign 0.00
R6260:Cfap52 UTSW 11 67938954 missense possibly damaging 0.85
R7401:Cfap52 UTSW 11 67949633 missense probably benign 0.02
R7580:Cfap52 UTSW 11 67946320 missense probably damaging 1.00
R7831:Cfap52 UTSW 11 67935956 missense possibly damaging 0.89
R7966:Cfap52 UTSW 11 67953745 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGTCATTCCAGCTATGTACACAC -3'
(R):5'- CAGATGCTCTCTGTGTCAGG -3'

Sequencing Primer
(F):5'- TTCAAACAGGGCCTCACTGTGTAG -3'
(R):5'- AGGTGCTCCCTGTGTCAG -3'
Posted On2020-07-28