Mutagenetix > Incidental Mutations

Incidental Mutation 'R8303:Gpc5'

639346

Institutional Source

Beutler Lab

Gene Symbol

Gpc5

Ensembl Gene

ENSMUSG00000022112

Gene Name

glypican 5

Synonyms

A230034F01Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8303 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

115092215-116525179 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 115428255 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 497 (I497K)

Ref Sequence

ENSEMBL: ENSMUSP00000135085 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022707] [ENSMUST00000176912]

Predicted Effect

probably benign
Transcript: ENSMUST00000022707
AA Change: I424K

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000022707
Gene: ENSMUSG00000022112
AA Change: I424K

Domain	Start	End	E-Value	Type
Pfam:Glypican	9	572	1.8e-182	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176912
AA Change: I497K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000135085
Gene: ENSMUSG00000022112
AA Change: I497K

Domain	Start	End	E-Value	Type
Pfam:Glypican	85	642	1.6e-174	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	T	C	6: 96,165,721	E114G	probably benign	Het
2810021J22Rik	T	A	11: 58,880,140	D149E	probably benign	Het
Aars2	T	C	17: 45,507,597	C103R	probably damaging	Het
Aass	T	C	6: 23,092,368	D591G	probably benign	Het
Arhgap32	A	G	9: 32,260,909	T1662A	probably benign	Het
Arhgap42	A	T	9: 9,009,326	I520N	probably damaging	Het
Arhgef3	T	C	14: 27,394,138	I279T	probably damaging	Het
Arid4b	A	G	13: 14,120,223	K30R	probably damaging	Het
Asxl3	C	T	18: 22,524,416	R1828W	probably benign	Het
Bid	T	C	6: 120,900,239	Y47C	probably benign	Het
Card6	T	C	15: 5,105,365	T119A	probably benign	Het
Cbr1	T	C	16: 93,610,017	I207T	probably damaging	Het
Cep135	T	C	5: 76,611,728	L443P	probably damaging	Het
Cfap43	T	A	19: 47,765,835	R1017*	probably null	Het
Cfap52	T	A	11: 67,939,795	S280C	probably benign	Het
Cntnap5b	T	C	1: 100,141,297	F81L	probably damaging	Het
Cyp4a12a	A	G	4: 115,328,933	D430G	probably damaging	Het
Cyp4f37	G	A	17: 32,634,178		probably null	Het
Dclre1a	A	G	19: 56,542,689	S742P	probably damaging	Het
Ddx54	T	C	5: 120,621,790	F414S	probably damaging	Het
Dsp	A	G	13: 38,197,343	N2688S	probably benign	Het
Elovl4	A	T	9: 83,788,267		probably null	Het
Erbin	A	C	13: 103,830,186		probably null	Het
Fsip2	A	G	2: 82,988,380	D4819G	probably benign	Het
Gapvd1	G	A	2: 34,712,200	P645L	probably damaging	Het
Gbp9	T	C	5: 105,081,305	E492G	possibly damaging	Het
Hlx	A	G	1: 184,727,708	L411P	probably damaging	Het
Hmmr	G	A	11: 40,721,672	S206F	probably damaging	Het
Ice1	A	T	13: 70,606,407	I520N	probably benign	Het
Ist1	T	C	8: 109,683,780		probably null	Het
Itga3	T	C	11: 95,062,640	D292G	probably benign	Het
Kif21a	T	C	15: 90,971,196	N655S	probably damaging	Het
Lrrtm1	A	G	6: 77,244,679	H373R	probably benign	Het
Ngdn	A	T	14: 55,023,145	H270L	probably benign	Het
Nol4	G	A	18: 23,040,174		probably benign	Het
Nxpe5	G	A	5: 138,241,002		probably benign	Het
Olfr1205	G	A	2: 88,831,289	M57I	possibly damaging	Het
Olfr26	A	C	9: 38,855,541	T160P	probably damaging	Het
Olfr347	A	G	2: 36,734,455	I45V	probably damaging	Het
Olfr948	A	C	9: 39,319,393	S74A	probably damaging	Het
Pask	C	A	1: 93,320,564	R1005L	probably benign	Het
Pcm1	A	G	8: 41,283,721	T875A	probably damaging	Het
Pdrg1	A	T	2: 153,009,667	I130N	probably damaging	Het
Plec	A	T	15: 76,189,266	M448K	unknown	Het
R3hdml	T	G	2: 163,499,912	V204G	probably damaging	Het
Rasa4	G	A	5: 136,089,381	V32M	possibly damaging	Het
Scaf8	T	C	17: 3,148,552	V44A	unknown	Het
Smad3	G	T	9: 63,667,478	P177T	probably benign	Het
Smpd4	T	A	16: 17,639,331	F384L	probably damaging	Het
Sycp2l	G	C	13: 41,129,799	L170F	probably damaging	Het
Tas2r107	T	C	6: 131,659,622	S155G	probably benign	Het
Tmem143	T	A	7: 45,916,570	M439K	probably benign	Het
Ttc41	A	T	10: 86,719,630	T317S	probably benign	Het
Umps	A	G	16: 33,963,870	V71A	possibly damaging	Het
Usp17lc	G	A	7: 103,418,182	G228D	possibly damaging	Het
Usp17ld	C	T	7: 103,250,816	C303Y	probably damaging	Het
Vmn2r65	C	A	7: 84,940,183	E842*	probably null	Het
Vmn2r94	A	G	17: 18,244,171	F619S	probably damaging	Het
Vps13a	T	C	19: 16,616,906	T3154A	probably benign	Het
Vps13b	C	T	15: 35,639,917	T1311I	probably damaging	Het
Wdr66	T	A	5: 123,322,587	V1204E	probably damaging	Het
Xpot	A	T	10: 121,611,500	Y353*	probably null	Het
Zfp319	A	T	8: 95,329,137	L146Q	probably damaging	Het
Zfp422	T	A	6: 116,626,651	H129L	probably damaging	Het
Zzef1	T	C	11: 72,917,189	F2709L	probably damaging	Het

Other mutations in Gpc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Gpc5	APN	14	115370024	missense	probably damaging	1.00
IGL01298:Gpc5	APN	14	115399188	missense	probably benign	0.14
IGL01359:Gpc5	APN	14	115369750	missense	possibly damaging	0.74
IGL02354:Gpc5	APN	14	115133287	nonsense	probably null
IGL02361:Gpc5	APN	14	115133287	nonsense	probably null
IGL02982:Gpc5	APN	14	115369988	missense	probably damaging	1.00
IGL03120:Gpc5	APN	14	115370144	missense	possibly damaging	0.64
R0322:Gpc5	UTSW	14	115399151	missense	probably benign	0.05
R0396:Gpc5	UTSW	14	115428208	missense	possibly damaging	0.91
R0555:Gpc5	UTSW	14	115552328	missense	probably damaging	0.98
R0629:Gpc5	UTSW	14	115552239	missense	possibly damaging	0.94
R1536:Gpc5	UTSW	14	115399250	missense	probably benign	0.09
R1660:Gpc5	UTSW	14	115399279	missense	probably benign	0.12
R1676:Gpc5	UTSW	14	115370098	missense	probably damaging	1.00
R2328:Gpc5	UTSW	14	115788179	missense	probably damaging	0.99
R3522:Gpc5	UTSW	14	116524335	missense	probably benign	0.00
R3776:Gpc5	UTSW	14	115370060	missense	probably benign	0.05
R3885:Gpc5	UTSW	14	115370060	missense	probably benign	0.05
R3889:Gpc5	UTSW	14	115370060	missense	probably benign	0.05
R3893:Gpc5	UTSW	14	115370060	missense	probably benign	0.05
R4041:Gpc5	UTSW	14	115133216	missense	probably damaging	1.00
R4517:Gpc5	UTSW	14	115552239	missense	possibly damaging	0.94
R5068:Gpc5	UTSW	14	115417264	makesense	probably null
R5639:Gpc5	UTSW	14	115092747	missense	probably benign	0.13
R5730:Gpc5	UTSW	14	115788314	missense	possibly damaging	0.73
R5944:Gpc5	UTSW	14	115369838	missense	probably benign	0.24
R6351:Gpc5	UTSW	14	115399200	missense	probably benign	0.01
R6557:Gpc5	UTSW	14	115092534	unclassified	probably benign
R6657:Gpc5	UTSW	14	115370198	missense	probably benign	0.01
R6714:Gpc5	UTSW	14	115552303	nonsense	probably null
R6751:Gpc5	UTSW	14	115369951	missense	probably benign	0.00
R7057:Gpc5	UTSW	14	115133242	missense	possibly damaging	0.64
R7142:Gpc5	UTSW	14	115417203	missense	probably benign	0.01
R7225:Gpc5	UTSW	14	115552298	missense	probably damaging	1.00
R7544:Gpc5	UTSW	14	115428173	missense	probably damaging	1.00
R7658:Gpc5	UTSW	14	115428208	missense	possibly damaging	0.91
R7695:Gpc5	UTSW	14	115092594	missense	unknown
R7785:Gpc5	UTSW	14	115417220	missense	probably benign	0.00
R8116:Gpc5	UTSW	14	115399225	missense	probably damaging	0.98
RF001:Gpc5	UTSW	14	115417178	missense	probably benign	0.41
RF022:Gpc5	UTSW	14	115552276	missense	probably damaging	1.00
Z1176:Gpc5	UTSW	14	115369964	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTCATGCAACTCTTCTGTGTG -3'
(R):5'- TGTACATTGCATAGAGGTGGAAATG -3'

Sequencing Primer
(F):5'- ATGCAACTCTTCTGTGTGGATTTTAC -3'
(R):5'- TCAGTTCAACACATGGTGGC -3'

Posted On

2020-07-28