Incidental Mutation 'R0005:Tmed4'
ID63937
Institutional Source Beutler Lab
Gene Symbol Tmed4
Ensembl Gene ENSMUSG00000004394
Gene Nametransmembrane p24 trafficking protein 4
Synonyms1110014L17Rik
MMRRC Submission 038301-MU
Accession Numbers

Genbank: NM_134020; MGI: 1915070

Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R0005 (G1)
Quality Score137
Status Validated
Chromosome11
Chromosomal Location6270369-6274870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6271781 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 185 (R185H)
Ref Sequence ENSEMBL: ENSMUSP00000004508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004507] [ENSMUST00000004508] [ENSMUST00000132147] [ENSMUST00000151446]
Predicted Effect probably benign
Transcript: ENSMUST00000004507
SMART Domains Protein: ENSMUSP00000004507
Gene: ENSMUSG00000004393

DomainStartEndE-ValueType
DEXDc 26 234 4.13e-46 SMART
low complexity region 246 256 N/A INTRINSIC
HELICc 272 380 2.42e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000004508
AA Change: R185H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004508
Gene: ENSMUSG00000004394
AA Change: R185H

DomainStartEndE-ValueType
EMP24_GP25L 29 222 3.21e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130621
Predicted Effect probably benign
Transcript: ENSMUST00000132147
SMART Domains Protein: ENSMUSP00000121643
Gene: ENSMUSG00000004394

DomainStartEndE-ValueType
EMP24_GP25L 29 170 3.3e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151446
SMART Domains Protein: ENSMUSP00000122368
Gene: ENSMUSG00000004393

DomainStartEndE-ValueType
DEXDc 26 216 3.65e-38 SMART
low complexity region 228 236 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155874
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency 98% (63/64)
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn2l A G 7: 126,498,274 F201L probably damaging Het
BC037034 T C 5: 138,262,654 probably null Het
Camsap3 T A 8: 3,604,288 F653I probably damaging Het
Col11a2 C T 17: 34,062,879 probably benign Het
Col27a1 A G 4: 63,225,400 T442A probably benign Het
Cpsf1 A G 15: 76,600,680 probably null Het
Enpp4 T C 17: 44,102,175 N156S probably benign Het
Fat3 T A 9: 15,962,866 N3485I probably damaging Het
Gabra2 C T 5: 70,973,436 V350I probably benign Het
Gm8909 G T 17: 36,162,192 probably benign Het
Hivep2 A G 10: 14,128,749 T364A probably damaging Het
Kif1b A T 4: 149,181,927 V402E probably damaging Het
Lamc3 A G 2: 31,922,428 D959G probably benign Het
Mag T A 7: 30,908,354 probably benign Het
Map3k1 A G 13: 111,755,704 F1006L probably benign Het
Mapre2 G A 18: 23,853,693 G54D probably damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myadm C T 7: 3,297,564 Q281* probably null Het
Mylk3 A T 8: 85,327,203 V625D possibly damaging Het
Nlrp9a T C 7: 26,573,788 probably benign Het
Olfr974 A G 9: 39,942,956 D232G probably benign Het
Plcz1 T A 6: 140,040,564 probably benign Het
Plekhg5 TCCCCC TCC 4: 152,112,651 probably benign Het
Plekhh2 A C 17: 84,586,433 D892A probably benign Het
Ppih A G 4: 119,318,601 probably benign Het
Pramef12 G T 4: 144,395,853 F40L probably damaging Het
Rtn4ip1 A T 10: 43,932,478 M84L probably benign Het
Slc35f4 G A 14: 49,322,486 probably benign Het
Spocd1 G T 4: 129,956,778 D866Y possibly damaging Het
Stxbp4 C T 11: 90,548,917 R365Q possibly damaging Het
Tmem2 A G 19: 21,812,220 T595A probably damaging Het
Tnfsf9 T C 17: 57,107,236 V221A possibly damaging Het
Vsx2 C A 12: 84,570,241 P100Q possibly damaging Het
Wdr48 T A 9: 119,909,434 D53E probably benign Het
Zfp335 T A 2: 164,909,302 S115C possibly damaging Het
Zfp608 G A 18: 54,895,520 P1274S possibly damaging Het
Other mutations in Tmed4
AlleleSourceChrCoordTypePredicted EffectPPH Score
3-1:Tmed4 UTSW 11 6273750 missense probably benign 0.01
P4717OSA:Tmed4 UTSW 11 6273727 unclassified probably benign
P4748:Tmed4 UTSW 11 6273727 unclassified probably benign
R1909:Tmed4 UTSW 11 6274694 missense probably damaging 1.00
R2926:Tmed4 UTSW 11 6271728 missense probably benign 0.01
R3081:Tmed4 UTSW 11 6274151 missense probably benign 0.09
R3801:Tmed4 UTSW 11 6274233 missense probably damaging 0.98
R4572:Tmed4 UTSW 11 6274461 frame shift probably null
R4748:Tmed4 UTSW 11 6271716 missense possibly damaging 0.67
R4858:Tmed4 UTSW 11 6274456 missense possibly damaging 0.64
R4997:Tmed4 UTSW 11 6274500 critical splice acceptor site probably null
R5788:Tmed4 UTSW 11 6271743 missense probably damaging 1.00
R6033:Tmed4 UTSW 11 6274491 nonsense probably null
R6033:Tmed4 UTSW 11 6274491 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGCCAGTGTGACACCAGTGAC -3'
(R):5'- GGCCTCTTAGTGGAGAAAGCATGG -3'

Sequencing Primer
(F):5'- TCCTCAAATTCCAGGTGGATG -3'
(R):5'- CATGGTTTCAGTCGGAACAG -3'
Posted On2013-07-30