Incidental Mutation 'R8304:Stim1'
ID639384
Institutional Source Beutler Lab
Gene Symbol Stim1
Ensembl Gene ENSMUSG00000030987
Gene Namestromal interaction molecule 1
SynonymsSIM
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8304 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location102267806-102437319 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102435481 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 547 (A547T)
Ref Sequence ENSEMBL: ENSMUSP00000033289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033289] [ENSMUST00000209255] [ENSMUST00000211457]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033289
AA Change: A547T

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033289
Gene: ENSMUSG00000030987
AA Change: A547T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
SAM 129 200 5.51e-6 SMART
SCOP:d1eq1a_ 229 334 1e-2 SMART
PDB:4O9B|D 237 340 3e-59 PDB
Pfam:SOAR 341 441 1.4e-46 PFAM
low complexity region 485 499 N/A INTRINSIC
low complexity region 601 631 N/A INTRINSIC
low complexity region 672 685 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000209255
AA Change: A655T
Predicted Effect probably benign
Transcript: ENSMUST00000211058
Predicted Effect probably benign
Transcript: ENSMUST00000211457
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal and postnatal lethality, with all mice dying by 2 weeks of age, and severe growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,107,128 probably null Het
Akap11 T C 14: 78,513,232 T572A Het
Amigo2 A T 15: 97,246,157 L128Q probably damaging Het
Ankrd12 A G 17: 65,984,547 I1297T possibly damaging Het
Arhgap32 T A 9: 32,255,937 C623* probably null Het
Armc2 T C 10: 41,947,939 Y511C probably damaging Het
Asb15 C T 6: 24,559,297 P147L possibly damaging Het
Caprin1 G T 2: 103,769,517 N604K probably damaging Het
Ccnl2 T C 4: 155,813,222 F113L probably benign Het
Cltc C T 11: 86,725,261 R393H probably benign Het
Cul4a G A 8: 13,127,727 C289Y possibly damaging Het
Cyp4a29 T A 4: 115,254,456 F477I probably damaging Het
Dapk2 C T 9: 66,231,745 A116V possibly damaging Het
Ddx60 T C 8: 61,998,769 I1231T possibly damaging Het
Eif5b A G 1: 38,045,693 I874V probably benign Het
Eral1 A T 11: 78,076,002 S196T probably damaging Het
Erc2 T G 14: 27,653,165 D113E probably damaging Het
Galm A G 17: 80,183,337 T308A probably damaging Het
Gm626 A G 14: 33,552,109 I1103V possibly damaging Het
Helz2 A T 2: 181,230,157 N2650K probably benign Het
Herc2 A G 7: 56,159,438 D2562G probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Hspbap1 T A 16: 35,787,325 L67* probably null Het
Irx3 T A 8: 91,800,206 D290V probably damaging Het
Kcns1 A T 2: 164,168,102 Y246N probably damaging Het
Kidins220 A G 12: 25,057,128 T1557A probably benign Het
Lrriq1 T C 10: 103,234,068 N29S possibly damaging Het
Mmp24 T C 2: 155,799,839 F196L possibly damaging Het
Mroh2b T C 15: 4,925,637 V704A probably damaging Het
Mst1 A G 9: 108,081,604 M112V probably benign Het
Myh8 C A 11: 67,304,336 H1659N possibly damaging Het
Nlgn1 C T 3: 26,133,385 C117Y probably damaging Het
Olfr110 A T 17: 37,499,370 T240S probably damaging Het
Olfr456 C T 6: 42,486,738 V152I probably benign Het
Olfr561 A G 7: 102,774,710 Y62C possibly damaging Het
Olfr983 A T 9: 40,092,354 I204N probably damaging Het
Opa1 C T 16: 29,597,671 T237M possibly damaging Het
P3h1 C T 4: 119,247,205 T641M probably damaging Het
Pak7 T C 2: 136,098,283 H537R probably benign Het
Ppp1r12b A T 1: 134,896,363 L174Q possibly damaging Het
Prkg1 A G 19: 30,724,184 V326A possibly damaging Het
Psmb3 T A 11: 97,711,169 C122S probably benign Het
Sh3bgrl3 C A 4: 134,128,001 A45S probably benign Het
Slc25a47 T C 12: 108,855,942 V219A possibly damaging Het
Slfn9 A C 11: 82,982,779 S433A probably benign Het
Spata13 A T 14: 60,756,508 R1136S possibly damaging Het
Stab1 C A 14: 31,148,954 A1313S probably benign Het
Taf5l A T 8: 124,003,512 I146N probably benign Het
Tbc1d12 A T 19: 38,837,380 E225V possibly damaging Het
Tesc T C 5: 118,056,430 Y135H probably benign Het
Tfg T C 16: 56,701,218 E145G possibly damaging Het
Tg T A 15: 66,693,260 C1150* probably null Het
Tmtc1 T C 6: 148,271,385 N616S probably damaging Het
Trpm7 A T 2: 126,797,877 W1600R probably damaging Het
Zfand1 A T 3: 10,348,555 L24* probably null Het
Zfp282 AGCGGCGGCGGCGGCGGC AGCGGCGGCGGCGGC 6: 47,904,788 probably benign Het
Zfp770 A C 2: 114,197,410 F59L probably damaging Het
Other mutations in Stim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Stim1 APN 7 102426747 missense probably damaging 1.00
IGL01390:Stim1 APN 7 102427162 missense possibly damaging 0.73
IGL01602:Stim1 APN 7 102386115 missense possibly damaging 0.86
IGL01605:Stim1 APN 7 102386115 missense possibly damaging 0.86
IGL01697:Stim1 APN 7 102425969 splice site probably benign
IGL01826:Stim1 APN 7 102427075 splice site probably benign
IGL01908:Stim1 APN 7 102435650 missense probably benign
IGL02869:Stim1 APN 7 102268551 missense unknown
IGL03146:Stim1 APN 7 102421355 missense probably damaging 1.00
R0217:Stim1 UTSW 7 102435800 missense probably benign 0.00
R1320:Stim1 UTSW 7 102408406 missense possibly damaging 0.79
R1639:Stim1 UTSW 7 102354541 missense probably benign 0.31
R1643:Stim1 UTSW 7 102386100 missense possibly damaging 0.92
R1697:Stim1 UTSW 7 102354506 missense probably damaging 1.00
R2424:Stim1 UTSW 7 102408405 missense probably benign 0.03
R3838:Stim1 UTSW 7 102411296 missense possibly damaging 0.71
R3940:Stim1 UTSW 7 102435641 missense probably benign 0.00
R4820:Stim1 UTSW 7 102415364 missense probably damaging 0.97
R4871:Stim1 UTSW 7 102354572 missense probably damaging 1.00
R5110:Stim1 UTSW 7 102268422 missense unknown
R5787:Stim1 UTSW 7 102435440 missense possibly damaging 0.52
R6400:Stim1 UTSW 7 102430950 missense probably null 0.99
R6788:Stim1 UTSW 7 102427291 missense probably damaging 0.99
R7112:Stim1 UTSW 7 102408408 missense probably benign 0.01
R7125:Stim1 UTSW 7 102435534 missense possibly damaging 0.69
R7247:Stim1 UTSW 7 102421532 critical splice donor site probably null
R7650:Stim1 UTSW 7 102428827 missense
R7807:Stim1 UTSW 7 102427141 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGTCCTGATGACTTACTCAAC -3'
(R):5'- ATCCAAAAGTGGGGAGCCAC -3'

Sequencing Primer
(F):5'- ACTCAACTTTCATTACTCATTCCTC -3'
(R):5'- CACCAGGTGGGACTGAGG -3'
Posted On2020-07-28