Incidental Mutation 'R8304:Cul4a'
ID639386
Institutional Source Beutler Lab
Gene Symbol Cul4a
Ensembl Gene ENSMUSG00000031446
Gene Namecullin 4A
Synonyms2810470J21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.683) question?
Stock #R8304 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location13105621-13147940 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13127727 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 289 (C289Y)
Ref Sequence ENSEMBL: ENSMUSP00000016680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016680] [ENSMUST00000121426] [ENSMUST00000125514]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016680
AA Change: C289Y

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000016680
Gene: ENSMUSG00000031446
AA Change: C289Y

DomainStartEndE-ValueType
low complexity region 20 39 N/A INTRINSIC
SCOP:d1ldja2 61 401 1e-118 SMART
Blast:CULLIN 83 151 5e-9 BLAST
CULLIN 434 582 1.6e-76 SMART
Blast:CULLIN 585 640 7e-28 BLAST
Cullin_Nedd8 688 753 8.29e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121426
SMART Domains Protein: ENSMUSP00000112525
Gene: ENSMUSG00000031446

DomainStartEndE-ValueType
low complexity region 20 39 N/A INTRINSIC
Pfam:Cullin 63 259 3.1e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125514
SMART Domains Protein: ENSMUSP00000123074
Gene: ENSMUSG00000031446

DomainStartEndE-ValueType
Pfam:Cullin 1 68 5.6e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CUL4A is the ubiquitin ligase component of a multimeric complex involved in the degradation of DNA damage-response proteins (Liu et al., 2009 [PubMed 19481525]).[supplied by OMIM, Oct 2009]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit reduced female fertility, male infertility, impaired spermatogenesis, and impaired DNA repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,107,128 probably null Het
Akap11 T C 14: 78,513,232 T572A Het
Amigo2 A T 15: 97,246,157 L128Q probably damaging Het
Ankrd12 A G 17: 65,984,547 I1297T possibly damaging Het
Arhgap32 T A 9: 32,255,937 C623* probably null Het
Armc2 T C 10: 41,947,939 Y511C probably damaging Het
Asb15 C T 6: 24,559,297 P147L possibly damaging Het
Caprin1 G T 2: 103,769,517 N604K probably damaging Het
Ccnl2 T C 4: 155,813,222 F113L probably benign Het
Cltc C T 11: 86,725,261 R393H probably benign Het
Cyp4a29 T A 4: 115,254,456 F477I probably damaging Het
Dapk2 C T 9: 66,231,745 A116V possibly damaging Het
Ddx60 T C 8: 61,998,769 I1231T possibly damaging Het
Eif5b A G 1: 38,045,693 I874V probably benign Het
Eral1 A T 11: 78,076,002 S196T probably damaging Het
Erc2 T G 14: 27,653,165 D113E probably damaging Het
Galm A G 17: 80,183,337 T308A probably damaging Het
Gm626 A G 14: 33,552,109 I1103V possibly damaging Het
Helz2 A T 2: 181,230,157 N2650K probably benign Het
Herc2 A G 7: 56,159,438 D2562G probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Hspbap1 T A 16: 35,787,325 L67* probably null Het
Irx3 T A 8: 91,800,206 D290V probably damaging Het
Kcns1 A T 2: 164,168,102 Y246N probably damaging Het
Kidins220 A G 12: 25,057,128 T1557A probably benign Het
Lrriq1 T C 10: 103,234,068 N29S possibly damaging Het
Mmp24 T C 2: 155,799,839 F196L possibly damaging Het
Mroh2b T C 15: 4,925,637 V704A probably damaging Het
Mst1 A G 9: 108,081,604 M112V probably benign Het
Myh8 C A 11: 67,304,336 H1659N possibly damaging Het
Nlgn1 C T 3: 26,133,385 C117Y probably damaging Het
Olfr110 A T 17: 37,499,370 T240S probably damaging Het
Olfr456 C T 6: 42,486,738 V152I probably benign Het
Olfr561 A G 7: 102,774,710 Y62C possibly damaging Het
Olfr983 A T 9: 40,092,354 I204N probably damaging Het
Opa1 C T 16: 29,597,671 T237M possibly damaging Het
P3h1 C T 4: 119,247,205 T641M probably damaging Het
Pak7 T C 2: 136,098,283 H537R probably benign Het
Ppp1r12b A T 1: 134,896,363 L174Q possibly damaging Het
Prkg1 A G 19: 30,724,184 V326A possibly damaging Het
Psmb3 T A 11: 97,711,169 C122S probably benign Het
Sh3bgrl3 C A 4: 134,128,001 A45S probably benign Het
Slc25a47 T C 12: 108,855,942 V219A possibly damaging Het
Slfn9 A C 11: 82,982,779 S433A probably benign Het
Spata13 A T 14: 60,756,508 R1136S possibly damaging Het
Stab1 C A 14: 31,148,954 A1313S probably benign Het
Stim1 G A 7: 102,435,481 A547T possibly damaging Het
Taf5l A T 8: 124,003,512 I146N probably benign Het
Tbc1d12 A T 19: 38,837,380 E225V possibly damaging Het
Tesc T C 5: 118,056,430 Y135H probably benign Het
Tfg T C 16: 56,701,218 E145G possibly damaging Het
Tg T A 15: 66,693,260 C1150* probably null Het
Tmtc1 T C 6: 148,271,385 N616S probably damaging Het
Trpm7 A T 2: 126,797,877 W1600R probably damaging Het
Ttc17 A T 2: 94,369,181 probably benign Het
Zfand1 A T 3: 10,348,555 L24* probably null Het
Zfp282 AGCGGCGGCGGCGGCGGC AGCGGCGGCGGCGGC 6: 47,904,788 probably benign Het
Zfp770 A C 2: 114,197,410 F59L probably damaging Het
Other mutations in Cul4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00720:Cul4a APN 8 13127735 missense probably benign 0.18
IGL00952:Cul4a APN 8 13146562 missense probably damaging 1.00
IGL01604:Cul4a APN 8 13133843 critical splice donor site probably null
IGL01688:Cul4a APN 8 13146571 nonsense probably null
IGL02167:Cul4a APN 8 13122826 missense probably damaging 1.00
IGL02927:Cul4a APN 8 13124861 missense possibly damaging 0.55
IGL03066:Cul4a APN 8 13133776 missense probably benign 0.22
R0183:Cul4a UTSW 8 13133790 missense probably damaging 0.98
R1600:Cul4a UTSW 8 13123954 missense probably damaging 1.00
R1860:Cul4a UTSW 8 13123565 missense probably damaging 1.00
R1865:Cul4a UTSW 8 13142589 missense possibly damaging 0.94
R1905:Cul4a UTSW 8 13133171 missense probably benign 0.06
R1964:Cul4a UTSW 8 13136406 missense possibly damaging 0.62
R1964:Cul4a UTSW 8 13136854 missense probably benign 0.00
R2381:Cul4a UTSW 8 13136887 missense probably benign 0.45
R3787:Cul4a UTSW 8 13133668 missense probably damaging 0.99
R4006:Cul4a UTSW 8 13122859 missense probably benign 0.04
R4007:Cul4a UTSW 8 13122859 missense probably benign 0.04
R4748:Cul4a UTSW 8 13123526 missense probably benign 0.06
R5244:Cul4a UTSW 8 13146566 missense probably damaging 1.00
R6389:Cul4a UTSW 8 13140278 missense probably benign
R6736:Cul4a UTSW 8 13136219 missense probably benign 0.00
R7201:Cul4a UTSW 8 13142991 missense probably damaging 0.98
R7313:Cul4a UTSW 8 13121676 critical splice acceptor site probably benign
R7446:Cul4a UTSW 8 13136874 missense probably benign
R7485:Cul4a UTSW 8 13140279 missense possibly damaging 0.68
R7569:Cul4a UTSW 8 13123493 missense probably benign
R8219:Cul4a UTSW 8 13146540 missense possibly damaging 0.91
X0026:Cul4a UTSW 8 13105871 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TGGGTTAGAATCATCAGCAAAAGCC -3'
(R):5'- TTACAAGGCAAGTGTGGTGG -3'

Sequencing Primer
(F):5'- ATGCCTGCTGTGTCTTCA -3'
(R):5'- CTATGAATTCCTTTGAGGGCTAAC -3'
Posted On2020-07-28