Mutagenetix > Incidental Mutation

Incidental Mutation 'R8304:Lrriq1'

639395

Institutional Source

Beutler Lab

Gene Symbol

Lrriq1

Ensembl Gene

ENSMUSG00000019892

Gene Name

leucine-rich repeats and IQ motif containing 1

Synonyms

LOC380658, 4930503E15Rik, Gm1557

MMRRC Submission

067791-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R8304 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103046031-103236322 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 103234068 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 29 (N29S)

Ref Sequence

ENSEMBL: ENSMUSP00000020043 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020043] [ENSMUST00000123364] [ENSMUST00000166240]

AlphaFold

Q0P5X1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020043
AA Change: N29S

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000020043
Gene: ENSMUSG00000019892
AA Change: N29S

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
Blast:IQ	290	312	1e-6	BLAST
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000123364
AA Change: N29S

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000119783
Gene: ENSMUSG00000019892
AA Change: N29S

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
Blast:IQ	290	312	6e-6	BLAST
coiled coil region	314	390	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166240
AA Change: N29S

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: N29S

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
IQ	290	312	9.78e1	SMART
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC
LRR	873	894	2.14e1	SMART
LRR	895	917	4.45e1	SMART
LRR	984	1005	2.03e2	SMART
LRR	1029	1052	3.65e0	SMART
low complexity region	1244	1258	N/A	INTRINSIC
IQ	1279	1301	5.61e1	SMART
IQ	1339	1361	6.7e-3	SMART
low complexity region	1369	1394	N/A	INTRINSIC
low complexity region	1502	1518	N/A	INTRINSIC
low complexity region	1528	1543	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

98% (58/59)

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	G	11: 110,107,128		probably null	Het
Akap11	T	C	14: 78,513,232	T572A		Het
Amigo2	A	T	15: 97,246,157	L128Q	probably damaging	Het
Ankrd12	A	G	17: 65,984,547	I1297T	possibly damaging	Het
Arhgap32	T	A	9: 32,255,937	C623*	probably null	Het
Armc2	T	C	10: 41,947,939	Y511C	probably damaging	Het
Asb15	C	T	6: 24,559,297	P147L	possibly damaging	Het
Caprin1	G	T	2: 103,769,517	N604K	probably damaging	Het
Ccnl2	T	C	4: 155,813,222	F113L	probably benign	Het
Cltc	C	T	11: 86,725,261	R393H	probably benign	Het
Cul4a	G	A	8: 13,127,727	C289Y	possibly damaging	Het
Cyp4a29	T	A	4: 115,254,456	F477I	probably damaging	Het
Dapk2	C	T	9: 66,231,745	A116V	possibly damaging	Het
Ddx60	T	C	8: 61,998,769	I1231T	possibly damaging	Het
Eif5b	A	G	1: 38,045,693	I874V	probably benign	Het
Eral1	A	T	11: 78,076,002	S196T	probably damaging	Het
Erc2	T	G	14: 27,653,165	D113E	probably damaging	Het
Frmpd2	A	G	14: 33,552,109	I1103V	possibly damaging	Het
Galm	A	G	17: 80,183,337	T308A	probably damaging	Het
Helz2	A	T	2: 181,230,157	N2650K	probably benign	Het
Herc2	A	G	7: 56,159,438	D2562G	probably damaging	Het
Hmmr	G	A	11: 40,721,672	S206F	probably damaging	Het
Hspbap1	T	A	16: 35,787,325	L67*	probably null	Het
Irx3	T	A	8: 91,800,206	D290V	probably damaging	Het
Kcns1	A	T	2: 164,168,102	Y246N	probably damaging	Het
Kidins220	A	G	12: 25,057,128	T1557A	probably benign	Het
Mmp24	T	C	2: 155,799,839	F196L	possibly damaging	Het
Mroh2b	T	C	15: 4,925,637	V704A	probably damaging	Het
Mst1	A	G	9: 108,081,604	M112V	probably benign	Het
Myh8	C	A	11: 67,304,336	H1659N	possibly damaging	Het
Nlgn1	C	T	3: 26,133,385	C117Y	probably damaging	Het
Olfr110	A	T	17: 37,499,370	T240S	probably damaging	Het
Olfr456	C	T	6: 42,486,738	V152I	probably benign	Het
Olfr561	A	G	7: 102,774,710	Y62C	possibly damaging	Het
Olfr983	A	T	9: 40,092,354	I204N	probably damaging	Het
Opa1	C	T	16: 29,597,671	T237M	possibly damaging	Het
P3h1	C	T	4: 119,247,205	T641M	probably damaging	Het
Pak7	T	C	2: 136,098,283	H537R	probably benign	Het
Ppp1r12b	A	T	1: 134,896,363	L174Q	possibly damaging	Het
Prkg1	A	G	19: 30,724,184	V326A	possibly damaging	Het
Psmb3	T	A	11: 97,711,169	C122S	probably benign	Het
Sh3bgrl3	C	A	4: 134,128,001	A45S	probably benign	Het
Slc25a47	T	C	12: 108,855,942	V219A	possibly damaging	Het
Slfn9	A	C	11: 82,982,779	S433A	probably benign	Het
Spata13	A	T	14: 60,756,508	R1136S	possibly damaging	Het
Stab1	C	A	14: 31,148,954	A1313S	probably benign	Het
Stim1	G	A	7: 102,435,481	A547T	possibly damaging	Het
Taf5l	A	T	8: 124,003,512	I146N	probably benign	Het
Tbc1d12	A	T	19: 38,837,380	E225V	possibly damaging	Het
Tesc	T	C	5: 118,056,430	Y135H	probably benign	Het
Tfg	T	C	16: 56,701,218	E145G	possibly damaging	Het
Tg	T	A	15: 66,693,260	C1150*	probably null	Het
Tmtc1	T	C	6: 148,271,385	N616S	probably damaging	Het
Trpm7	A	T	2: 126,797,877	W1600R	probably damaging	Het
Ttc17	A	T	2: 94,369,181		probably benign	Het
Zfand1	A	T	3: 10,348,555	L24*	probably null	Het
Zfp282	AGCGGCGGCGGCGGCGGC	AGCGGCGGCGGCGGC	6: 47,904,788		probably benign	Het
Zfp770	A	C	2: 114,197,410	F59L	probably damaging	Het

Other mutations in Lrriq1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00988:Lrriq1	APN	10	103161896	missense	probably damaging	0.99
IGL01523:Lrriq1	APN	10	103218116	nonsense	probably null
IGL01637:Lrriq1	APN	10	103215628	missense	probably benign
IGL02019:Lrriq1	APN	10	103178800	missense	probably benign	0.02
IGL02153:Lrriq1	APN	10	103170479	missense	probably benign	0.01
IGL02341:Lrriq1	APN	10	103224941	missense	probably benign	0.03
IGL02343:Lrriq1	APN	10	103234163	splice site	probably benign
IGL02408:Lrriq1	APN	10	103146281	missense	probably benign	0.17
IGL02431:Lrriq1	APN	10	103200639	missense	probably damaging	1.00
IGL02540:Lrriq1	APN	10	103215019	missense	probably benign	0.02
IGL02558:Lrriq1	APN	10	103146283	missense	probably damaging	1.00
IGL02613:Lrriq1	APN	10	103144548	missense	probably damaging	0.99
IGL02642:Lrriq1	APN	10	103221461	critical splice acceptor site	probably null
IGL03027:Lrriq1	APN	10	103227196	missense	probably benign	0.35
PIT4362001:Lrriq1	UTSW	10	103071194	missense	probably benign	0.26
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0124:Lrriq1	UTSW	10	103170420	critical splice donor site	probably null
R0244:Lrriq1	UTSW	10	103215773	missense	probably damaging	0.98
R0323:Lrriq1	UTSW	10	103221289	missense	possibly damaging	0.91
R0515:Lrriq1	UTSW	10	103068968	splice site	probably null
R0522:Lrriq1	UTSW	10	103161777	missense	probably damaging	0.99
R0701:Lrriq1	UTSW	10	103234044	missense	probably benign
R1220:Lrriq1	UTSW	10	103071129	missense	probably benign	0.05
R1261:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1262:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1451:Lrriq1	UTSW	10	103202515	splice site	probably benign
R1642:Lrriq1	UTSW	10	103214456	missense	probably benign	0.13
R1643:Lrriq1	UTSW	10	103214824	missense	probably benign	0.00
R1647:Lrriq1	UTSW	10	103170648	nonsense	probably null
R1830:Lrriq1	UTSW	10	103161759	missense	probably benign
R1843:Lrriq1	UTSW	10	103227173	splice site	probably null
R2128:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2129:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2199:Lrriq1	UTSW	10	103068913	missense	probably damaging	1.00
R2354:Lrriq1	UTSW	10	103189987	missense	probably damaging	1.00
R2495:Lrriq1	UTSW	10	103202381	missense	probably damaging	0.97
R2897:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2898:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2922:Lrriq1	UTSW	10	103214675	missense	probably benign	0.00
R2939:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R2965:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R2966:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R3081:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R3115:Lrriq1	UTSW	10	103170433	missense	probably benign	0.00
R3745:Lrriq1	UTSW	10	103170856	missense	probably damaging	0.99
R3813:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3814:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3885:Lrriq1	UTSW	10	103216106	missense	probably damaging	0.96
R4378:Lrriq1	UTSW	10	103202364	missense	probably damaging	1.00
R4632:Lrriq1	UTSW	10	103221427	missense	probably damaging	1.00
R4633:Lrriq1	UTSW	10	103200563	nonsense	probably null
R4663:Lrriq1	UTSW	10	103063412	missense	possibly damaging	0.88
R4702:Lrriq1	UTSW	10	103215749	missense	possibly damaging	0.65
R4793:Lrriq1	UTSW	10	103170466	missense	probably benign	0.25
R4801:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4802:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4815:Lrriq1	UTSW	10	103144878	missense	probably benign	0.10
R4872:Lrriq1	UTSW	10	103178788	missense	possibly damaging	0.56
R4877:Lrriq1	UTSW	10	103234038	missense	possibly damaging	0.88
R4894:Lrriq1	UTSW	10	103161752	missense	possibly damaging	0.86
R4990:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R4991:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R5011:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5013:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5122:Lrriq1	UTSW	10	103187453	missense	probably damaging	1.00
R5282:Lrriq1	UTSW	10	103215345	missense	probably benign	0.01
R5311:Lrriq1	UTSW	10	103214587	missense	probably damaging	1.00
R5567:Lrriq1	UTSW	10	103170596	missense	possibly damaging	0.56
R5643:Lrriq1	UTSW	10	103215440	missense	probably benign	0.00
R5683:Lrriq1	UTSW	10	103173375	missense	probably damaging	1.00
R5916:Lrriq1	UTSW	10	103221382	nonsense	probably null
R6008:Lrriq1	UTSW	10	103170464	missense	probably damaging	1.00
R6022:Lrriq1	UTSW	10	103215534	missense	possibly damaging	0.90
R6224:Lrriq1	UTSW	10	103215757	missense	probably damaging	1.00
R6254:Lrriq1	UTSW	10	103215451	missense	probably benign	0.15
R6311:Lrriq1	UTSW	10	103173393	missense	probably benign	0.03
R6460:Lrriq1	UTSW	10	103200698	missense	probably damaging	1.00
R6502:Lrriq1	UTSW	10	103227184	missense	probably damaging	0.99
R6637:Lrriq1	UTSW	10	103221432	missense	probably benign	0.06
R6719:Lrriq1	UTSW	10	103071116	missense	probably damaging	1.00
R6736:Lrriq1	UTSW	10	103181889	critical splice acceptor site	probably null
R6928:Lrriq1	UTSW	10	103214939	missense	possibly damaging	0.95
R6991:Lrriq1	UTSW	10	103187458	missense	probably damaging	1.00
R7174:Lrriq1	UTSW	10	103224965	missense	probably benign
R7241:Lrriq1	UTSW	10	103215973	missense	probably damaging	1.00
R7248:Lrriq1	UTSW	10	103223750	missense	possibly damaging	0.85
R7287:Lrriq1	UTSW	10	103216016	missense	probably benign	0.00
R7402:Lrriq1	UTSW	10	103221324	missense	possibly damaging	0.87
R7439:Lrriq1	UTSW	10	103214519	missense	probably benign	0.21
R7585:Lrriq1	UTSW	10	103214946	missense	possibly damaging	0.93
R7611:Lrriq1	UTSW	10	103200571	missense	possibly damaging	0.54
R7634:Lrriq1	UTSW	10	103200601	missense	probably damaging	1.00
R7767:Lrriq1	UTSW	10	103215954	missense	probably damaging	0.99
R7809:Lrriq1	UTSW	10	103215817	missense	probably damaging	0.99
R7910:Lrriq1	UTSW	10	103215194	nonsense	probably null
R8131:Lrriq1	UTSW	10	103215711	missense	possibly damaging	0.57
R8156:Lrriq1	UTSW	10	103156335	critical splice donor site	probably null
R8211:Lrriq1	UTSW	10	103170547	missense	probably damaging	1.00
R8487:Lrriq1	UTSW	10	103215053	missense	probably damaging	0.98
R8500:Lrriq1	UTSW	10	103046155	missense
R9013:Lrriq1	UTSW	10	103215070	missense	probably damaging	1.00
R9099:Lrriq1	UTSW	10	103216003	missense	probably damaging	0.98
R9155:Lrriq1	UTSW	10	103214779	missense	probably benign	0.03
R9320:Lrriq1	UTSW	10	103221283	missense	probably benign
R9384:Lrriq1	UTSW	10	103170597	missense	probably benign	0.00
R9469:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R9585:Lrriq1	UTSW	10	103215389	missense	probably benign
R9706:Lrriq1	UTSW	10	103046041	missense
R9780:Lrriq1	UTSW	10	103189963	missense	probably damaging	1.00
X0026:Lrriq1	UTSW	10	103215704	nonsense	probably null
Z1088:Lrriq1	UTSW	10	103202446	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202359	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202360	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103234085	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACCTGAGAGTATATGGGTAGCACAG -3'
(R):5'- AGTGGGTCATGTGACAAATTTGAAC -3'

Sequencing Primer
(F):5'- ATATGGGTAGCACAGATGGTTC -3'
(R):5'- GGTCATGTGACAAATTTGAACCCATG -3'

Posted On

2020-07-28