Incidental Mutation 'R8304:Erc2'
ID639405
Institutional Source Beutler Lab
Gene Symbol Erc2
Ensembl Gene ENSMUSG00000040640
Gene NameELKS/RAB6-interacting/CAST family member 2
SynonymsELKS2alpha, D14Ertd171e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8304 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location27622428-28478537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 27653165 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 113 (D113E)
Ref Sequence ENSEMBL: ENSMUSP00000087773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090302] [ENSMUST00000210135] [ENSMUST00000210327] [ENSMUST00000211087] [ENSMUST00000211145]
Predicted Effect probably damaging
Transcript: ENSMUST00000090302
AA Change: D113E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000087773
Gene: ENSMUSG00000040640
AA Change: D113E

DomainStartEndE-ValueType
low complexity region 14 45 N/A INTRINSIC
low complexity region 121 133 N/A INTRINSIC
Pfam:Cast 150 907 N/A PFAM
low complexity region 916 928 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000210135
AA Change: D113E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000210327
AA Change: D113E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000211087
AA Change: D113E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000211145
AA Change: D113E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.0718 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Rab3-interacting molecule (RIM)-binding protein family. Members of this protein family form part of the cytomatrix at the active zone (CAZ) complex and function as regulators of neurotransmitter release. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for targeted disruptions of this gene are viable and fertile. However, homozygotes for one allele display abnormal CNS synaptic transmission. Homozygotes for a second allele display retinal abnormalities and impaired vision. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,107,128 probably null Het
Akap11 T C 14: 78,513,232 T572A Het
Amigo2 A T 15: 97,246,157 L128Q probably damaging Het
Ankrd12 A G 17: 65,984,547 I1297T possibly damaging Het
Arhgap32 T A 9: 32,255,937 C623* probably null Het
Armc2 T C 10: 41,947,939 Y511C probably damaging Het
Asb15 C T 6: 24,559,297 P147L possibly damaging Het
Caprin1 G T 2: 103,769,517 N604K probably damaging Het
Ccnl2 T C 4: 155,813,222 F113L probably benign Het
Cltc C T 11: 86,725,261 R393H probably benign Het
Cul4a G A 8: 13,127,727 C289Y possibly damaging Het
Cyp4a29 T A 4: 115,254,456 F477I probably damaging Het
Dapk2 C T 9: 66,231,745 A116V possibly damaging Het
Ddx60 T C 8: 61,998,769 I1231T possibly damaging Het
Eif5b A G 1: 38,045,693 I874V probably benign Het
Eral1 A T 11: 78,076,002 S196T probably damaging Het
Galm A G 17: 80,183,337 T308A probably damaging Het
Gm626 A G 14: 33,552,109 I1103V possibly damaging Het
Helz2 A T 2: 181,230,157 N2650K probably benign Het
Herc2 A G 7: 56,159,438 D2562G probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Hspbap1 T A 16: 35,787,325 L67* probably null Het
Irx3 T A 8: 91,800,206 D290V probably damaging Het
Kcns1 A T 2: 164,168,102 Y246N probably damaging Het
Kidins220 A G 12: 25,057,128 T1557A probably benign Het
Lrriq1 T C 10: 103,234,068 N29S possibly damaging Het
Mmp24 T C 2: 155,799,839 F196L possibly damaging Het
Mroh2b T C 15: 4,925,637 V704A probably damaging Het
Mst1 A G 9: 108,081,604 M112V probably benign Het
Myh8 C A 11: 67,304,336 H1659N possibly damaging Het
Nlgn1 C T 3: 26,133,385 C117Y probably damaging Het
Olfr110 A T 17: 37,499,370 T240S probably damaging Het
Olfr456 C T 6: 42,486,738 V152I probably benign Het
Olfr561 A G 7: 102,774,710 Y62C possibly damaging Het
Olfr983 A T 9: 40,092,354 I204N probably damaging Het
Opa1 C T 16: 29,597,671 T237M possibly damaging Het
P3h1 C T 4: 119,247,205 T641M probably damaging Het
Pak7 T C 2: 136,098,283 H537R probably benign Het
Ppp1r12b A T 1: 134,896,363 L174Q possibly damaging Het
Prkg1 A G 19: 30,724,184 V326A possibly damaging Het
Psmb3 T A 11: 97,711,169 C122S probably benign Het
Sh3bgrl3 C A 4: 134,128,001 A45S probably benign Het
Slc25a47 T C 12: 108,855,942 V219A possibly damaging Het
Slfn9 A C 11: 82,982,779 S433A probably benign Het
Spata13 A T 14: 60,756,508 R1136S possibly damaging Het
Stab1 C A 14: 31,148,954 A1313S probably benign Het
Stim1 G A 7: 102,435,481 A547T possibly damaging Het
Taf5l A T 8: 124,003,512 I146N probably benign Het
Tbc1d12 A T 19: 38,837,380 E225V possibly damaging Het
Tesc T C 5: 118,056,430 Y135H probably benign Het
Tfg T C 16: 56,701,218 E145G possibly damaging Het
Tg T A 15: 66,693,260 C1150* probably null Het
Tmtc1 T C 6: 148,271,385 N616S probably damaging Het
Trpm7 A T 2: 126,797,877 W1600R probably damaging Het
Ttc17 A T 2: 94,369,181 probably benign Het
Zfand1 A T 3: 10,348,555 L24* probably null Het
Zfp282 AGCGGCGGCGGCGGCGGC AGCGGCGGCGGCGGC 6: 47,904,788 probably benign Het
Zfp770 A C 2: 114,197,410 F59L probably damaging Het
Other mutations in Erc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Erc2 APN 14 28040521 missense probably damaging 0.98
IGL01862:Erc2 APN 14 28271569 splice site probably benign
IGL01906:Erc2 APN 14 28141306 missense probably damaging 0.99
IGL02177:Erc2 APN 14 27898623 missense probably benign 0.00
IGL02481:Erc2 APN 14 27653071 missense probably damaging 1.00
IGL02483:Erc2 APN 14 27653071 missense probably damaging 1.00
IGL02623:Erc2 APN 14 27776980 missense probably damaging 1.00
IGL03252:Erc2 APN 14 28475649 utr 3 prime probably benign
IGL03378:Erc2 APN 14 28011723 missense probably damaging 1.00
lobe UTSW 14 28317251 missense probably damaging 0.96
R0091:Erc2 UTSW 14 27776824 critical splice acceptor site probably null
R0309:Erc2 UTSW 14 28141225 missense probably damaging 0.98
R0357:Erc2 UTSW 14 27777022 missense probably damaging 0.99
R0378:Erc2 UTSW 14 28011694 missense probably damaging 1.00
R0550:Erc2 UTSW 14 28271651 missense possibly damaging 0.74
R0815:Erc2 UTSW 14 28025148 missense probably benign 0.04
R0863:Erc2 UTSW 14 28025148 missense probably benign 0.04
R1121:Erc2 UTSW 14 28475655 utr 3 prime probably benign
R1164:Erc2 UTSW 14 28302972 missense probably damaging 0.99
R1498:Erc2 UTSW 14 28302898 missense probably benign 0.27
R1500:Erc2 UTSW 14 28271660 missense probably damaging 0.98
R1555:Erc2 UTSW 14 28011665 missense probably damaging 0.99
R1894:Erc2 UTSW 14 28141228 missense probably damaging 0.99
R1950:Erc2 UTSW 14 27912900 missense probably damaging 0.99
R1991:Erc2 UTSW 14 28011636 missense probably benign 0.34
R2698:Erc2 UTSW 14 28271705 missense probably benign 0.06
R2847:Erc2 UTSW 14 28040488 missense probably damaging 0.97
R3015:Erc2 UTSW 14 28011775 critical splice donor site probably null
R3612:Erc2 UTSW 14 27777177 missense possibly damaging 0.69
R3759:Erc2 UTSW 14 28025163 missense possibly damaging 0.94
R3857:Erc2 UTSW 14 28475642 utr 3 prime probably benign
R3858:Erc2 UTSW 14 28475642 utr 3 prime probably benign
R3859:Erc2 UTSW 14 28475642 utr 3 prime probably benign
R4556:Erc2 UTSW 14 28302904 missense probably damaging 1.00
R4739:Erc2 UTSW 14 27776881 missense probably damaging 1.00
R4898:Erc2 UTSW 14 27653328 missense probably damaging 1.00
R5068:Erc2 UTSW 14 28302943 missense possibly damaging 0.63
R5113:Erc2 UTSW 14 27652872 missense probably benign 0.40
R5418:Erc2 UTSW 14 27966510 missense probably benign 0.14
R5741:Erc2 UTSW 14 28302869 splice site probably null
R5819:Erc2 UTSW 14 28141369 missense probably damaging 0.97
R5930:Erc2 UTSW 14 27776858 missense probably damaging 0.99
R6073:Erc2 UTSW 14 28011636 missense probably benign 0.00
R6150:Erc2 UTSW 14 28141291 missense probably damaging 0.97
R6182:Erc2 UTSW 14 28317253 missense probably damaging 0.99
R6188:Erc2 UTSW 14 28317251 missense probably damaging 0.96
R6267:Erc2 UTSW 14 28080155 missense probably damaging 1.00
R6296:Erc2 UTSW 14 28080155 missense probably damaging 1.00
R6730:Erc2 UTSW 14 27898567 missense possibly damaging 0.95
R6969:Erc2 UTSW 14 27898596 missense probably damaging 1.00
R7095:Erc2 UTSW 14 27898593 missense probably damaging 0.99
R7221:Erc2 UTSW 14 27653158 missense probably damaging 0.97
R7365:Erc2 UTSW 14 28040389 missense probably damaging 1.00
R7454:Erc2 UTSW 14 28302991 missense possibly damaging 0.92
R7763:Erc2 UTSW 14 27876204 critical splice donor site probably null
R7784:Erc2 UTSW 14 27898594 missense probably damaging 0.96
R7890:Erc2 UTSW 14 28040341 critical splice acceptor site probably null
R7894:Erc2 UTSW 14 27777208 missense probably damaging 1.00
R8031:Erc2 UTSW 14 28011692 missense probably damaging 0.99
R8206:Erc2 UTSW 14 28303015 splice site probably null
R8273:Erc2 UTSW 14 27777139 missense probably benign 0.41
R8387:Erc2 UTSW 14 27653296 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCCAGTCCCTTAATGCAGCC -3'
(R):5'- ATGCTGTTCATGGAAGACCC -3'

Sequencing Primer
(F):5'- GCCTATGCTACGTCTGGAC -3'
(R):5'- TCATGGAAGACCCCAGTTTG -3'
Posted On2020-07-28