Mutagenetix > Incidental Mutation

Incidental Mutation 'R8304:Tg'

639411

Institutional Source

Beutler Lab

Gene Symbol

Ensembl Gene

ENSMUSG00000053469

Gene Name

thyroglobulin

Synonyms

Tgn

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.141) question?

Stock #

R8304 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

66670753-66850721 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 66693260 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 1150 (C1150*)

Ref Sequence

ENSEMBL: ENSMUSP00000070239 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065916] [ENSMUST00000163495]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000065916
AA Change: C1150*

SMART Domains

Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469
AA Change: C1150*

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
TY	50	97	5.9e-16	SMART
TY	118	165	5.59e-17	SMART
Pfam:Thyroglobulin_1	174	252	4e-9	PFAM
TY	317	363	4.36e-19	SMART
low complexity region	495	504	N/A	INTRINSIC
TY	617	662	3.58e-15	SMART
TY	684	730	1.47e-16	SMART
TY	880	926	1.51e-4	SMART
TY	1029	1078	1.21e-12	SMART
TY	1106	1150	7.56e-5	SMART
TY	1167	1215	7.26e-16	SMART
low complexity region	1244	1255	N/A	INTRINSIC
Pfam:GCC2_GCC3	1464	1509	2.7e-16	PFAM
TY	1519	1568	9.81e-13	SMART
Pfam:COesterase	2181	2717	8.4e-140	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163495

SMART Domains

Protein: ENSMUSP00000129868
Gene: ENSMUSG00000053469

Domain	Start	End	E-Value	Type
TY	14	63	1.21e-12	SMART

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	G	11: 110,107,128		probably null	Het
Akap11	T	C	14: 78,513,232	T572A		Het
Amigo2	A	T	15: 97,246,157	L128Q	probably damaging	Het
Ankrd12	A	G	17: 65,984,547	I1297T	possibly damaging	Het
Arhgap32	T	A	9: 32,255,937	C623*	probably null	Het
Armc2	T	C	10: 41,947,939	Y511C	probably damaging	Het
Asb15	C	T	6: 24,559,297	P147L	possibly damaging	Het
Caprin1	G	T	2: 103,769,517	N604K	probably damaging	Het
Ccnl2	T	C	4: 155,813,222	F113L	probably benign	Het
Cltc	C	T	11: 86,725,261	R393H	probably benign	Het
Cul4a	G	A	8: 13,127,727	C289Y	possibly damaging	Het
Cyp4a29	T	A	4: 115,254,456	F477I	probably damaging	Het
Dapk2	C	T	9: 66,231,745	A116V	possibly damaging	Het
Ddx60	T	C	8: 61,998,769	I1231T	possibly damaging	Het
Eif5b	A	G	1: 38,045,693	I874V	probably benign	Het
Eral1	A	T	11: 78,076,002	S196T	probably damaging	Het
Erc2	T	G	14: 27,653,165	D113E	probably damaging	Het
Frmpd2	A	G	14: 33,552,109	I1103V	possibly damaging	Het
Galm	A	G	17: 80,183,337	T308A	probably damaging	Het
Helz2	A	T	2: 181,230,157	N2650K	probably benign	Het
Herc2	A	G	7: 56,159,438	D2562G	probably damaging	Het
Hmmr	G	A	11: 40,721,672	S206F	probably damaging	Het
Hspbap1	T	A	16: 35,787,325	L67*	probably null	Het
Irx3	T	A	8: 91,800,206	D290V	probably damaging	Het
Kcns1	A	T	2: 164,168,102	Y246N	probably damaging	Het
Kidins220	A	G	12: 25,057,128	T1557A	probably benign	Het
Lrriq1	T	C	10: 103,234,068	N29S	possibly damaging	Het
Mmp24	T	C	2: 155,799,839	F196L	possibly damaging	Het
Mroh2b	T	C	15: 4,925,637	V704A	probably damaging	Het
Mst1	A	G	9: 108,081,604	M112V	probably benign	Het
Myh8	C	A	11: 67,304,336	H1659N	possibly damaging	Het
Nlgn1	C	T	3: 26,133,385	C117Y	probably damaging	Het
Olfr110	A	T	17: 37,499,370	T240S	probably damaging	Het
Olfr456	C	T	6: 42,486,738	V152I	probably benign	Het
Olfr561	A	G	7: 102,774,710	Y62C	possibly damaging	Het
Olfr983	A	T	9: 40,092,354	I204N	probably damaging	Het
Opa1	C	T	16: 29,597,671	T237M	possibly damaging	Het
P3h1	C	T	4: 119,247,205	T641M	probably damaging	Het
Pak7	T	C	2: 136,098,283	H537R	probably benign	Het
Ppp1r12b	A	T	1: 134,896,363	L174Q	possibly damaging	Het
Prkg1	A	G	19: 30,724,184	V326A	possibly damaging	Het
Psmb3	T	A	11: 97,711,169	C122S	probably benign	Het
Sh3bgrl3	C	A	4: 134,128,001	A45S	probably benign	Het
Slc25a47	T	C	12: 108,855,942	V219A	possibly damaging	Het
Slfn9	A	C	11: 82,982,779	S433A	probably benign	Het
Spata13	A	T	14: 60,756,508	R1136S	possibly damaging	Het
Stab1	C	A	14: 31,148,954	A1313S	probably benign	Het
Stim1	G	A	7: 102,435,481	A547T	possibly damaging	Het
Taf5l	A	T	8: 124,003,512	I146N	probably benign	Het
Tbc1d12	A	T	19: 38,837,380	E225V	possibly damaging	Het
Tesc	T	C	5: 118,056,430	Y135H	probably benign	Het
Tfg	T	C	16: 56,701,218	E145G	possibly damaging	Het
Tmtc1	T	C	6: 148,271,385	N616S	probably damaging	Het
Trpm7	A	T	2: 126,797,877	W1600R	probably damaging	Het
Ttc17	A	T	2: 94,369,181		probably benign	Het
Zfand1	A	T	3: 10,348,555	L24*	probably null	Het
Zfp282	AGCGGCGGCGGCGGCGGC	AGCGGCGGCGGCGGC	6: 47,904,788		probably benign	Het
Zfp770	A	C	2: 114,197,410	F59L	probably damaging	Het

Other mutations in Tg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Tg	APN	15	66847166	missense	probably damaging	1.00
IGL00230:Tg	APN	15	66827290	missense	probably benign	0.00
IGL00324:Tg	APN	15	66693424	missense	probably benign
IGL00428:Tg	APN	15	66773424	missense	probably benign	0.33
IGL00703:Tg	APN	15	66696489	missense	probably benign	0.34
IGL00808:Tg	APN	15	66683813	missense	probably damaging	1.00
IGL00833:Tg	APN	15	66688801	missense	probably benign	0.34
IGL00899:Tg	APN	15	66674073	critical splice donor site	probably null
IGL00921:Tg	APN	15	66764453	missense	probably benign	0.28
IGL00975:Tg	APN	15	66681882	missense	probably benign
IGL01288:Tg	APN	15	66736276	missense	possibly damaging	0.81
IGL01397:Tg	APN	15	66696092	splice site	probably benign
IGL01634:Tg	APN	15	66729566	missense	probably benign	0.34
IGL01646:Tg	APN	15	66678087	missense	probably damaging	1.00
IGL01704:Tg	APN	15	66671351	missense	probably damaging	0.98
IGL01958:Tg	APN	15	66759486	missense	probably benign	0.06
IGL02093:Tg	APN	15	66692374	missense	possibly damaging	0.83
IGL02113:Tg	APN	15	66705330	missense	probably benign	0.08
IGL02138:Tg	APN	15	66717233	missense	probably benign	0.01
IGL02156:Tg	APN	15	66705348	missense	probably benign	0.19
IGL02169:Tg	APN	15	66757943	missense	probably benign	0.04
IGL02342:Tg	APN	15	66764291	missense	probably benign
IGL02434:Tg	APN	15	66764342	missense	probably damaging	0.97
IGL02506:Tg	APN	15	66741594	missense	possibly damaging	0.71
IGL02513:Tg	APN	15	66705274	missense	probably benign
IGL02549:Tg	APN	15	66839361	missense	probably damaging	1.00
IGL02669:Tg	APN	15	66748726	splice site	probably benign
IGL02756:Tg	APN	15	66734586	missense	probably benign
IGL02800:Tg	APN	15	66757886	missense	probably damaging	1.00
IGL02828:Tg	APN	15	66682394	missense	probably damaging	1.00
IGL02927:Tg	APN	15	66678093	missense	probably damaging	1.00
IGL03061:Tg	APN	15	66671405	missense	probably damaging	1.00
IGL03105:Tg	APN	15	66715106	missense	probably benign	0.01
IGL03160:Tg	APN	15	66839303	nonsense	probably null
IGL03242:Tg	APN	15	66683798	missense	probably damaging	0.99
Also_ran	UTSW	15	66678839	missense	probably damaging	1.00
bedraggled	UTSW	15	66740714	missense	probably damaging	1.00
foster	UTSW	15	66693260	nonsense	probably null
hognose	UTSW	15	66717208	missense	probably damaging	0.99
ito	UTSW	15	66766162	nonsense	probably null
ito2	UTSW	15	66671396	missense	probably damaging	1.00
ito3	UTSW	15	66773474	missense	probably damaging	1.00
ito4	UTSW	15	66696520	missense	possibly damaging	0.47
Papua	UTSW	15	66674050	missense	probably damaging	1.00
Pipistrella	UTSW	15	66696135	missense	probably damaging	1.00
pluribus	UTSW	15	66715163	missense	probably damaging	0.98
samarai	UTSW	15	66758006	critical splice donor site	probably null
sariba	UTSW	15	66694870	missense	probably benign	0.01
ticker	UTSW	15	66827382	nonsense	probably null
Vampire	UTSW	15	66682827	missense	probably damaging	1.00
IGL03134:Tg	UTSW	15	66740718	missense	probably damaging	1.00
P0019:Tg	UTSW	15	66688863	missense	probably benign	0.01
R0121:Tg	UTSW	15	66740781	missense	probably benign	0.04
R0135:Tg	UTSW	15	66694870	missense	probably benign	0.01
R0227:Tg	UTSW	15	66698446	missense	possibly damaging	0.84
R0448:Tg	UTSW	15	66764442	missense	probably damaging	1.00
R0453:Tg	UTSW	15	66828533	missense	probably benign	0.09
R0504:Tg	UTSW	15	66682404	missense	probably damaging	0.97
R0543:Tg	UTSW	15	66729597	missense	probably benign	0.13
R0638:Tg	UTSW	15	66717208	missense	probably damaging	0.99
R0639:Tg	UTSW	15	66741484	critical splice acceptor site	probably null
R0646:Tg	UTSW	15	66729626	missense	probably damaging	0.99
R0666:Tg	UTSW	15	66737521	missense	probably benign
R0673:Tg	UTSW	15	66741484	critical splice acceptor site	probably null
R0689:Tg	UTSW	15	66839404	splice site	probably benign
R0704:Tg	UTSW	15	66757880	missense	probably benign	0.02
R0730:Tg	UTSW	15	66678789	missense	probably damaging	1.00
R0830:Tg	UTSW	15	66725144	missense	probably damaging	1.00
R0959:Tg	UTSW	15	66708010	missense	probably damaging	0.98
R1027:Tg	UTSW	15	66672409	missense	possibly damaging	0.65
R1061:Tg	UTSW	15	66698559	missense	probably benign	0.09
R1086:Tg	UTSW	15	66684062	missense	probably benign
R1103:Tg	UTSW	15	66719655	missense	probably benign	0.45
R1240:Tg	UTSW	15	66828548	missense	probably benign	0.16
R1281:Tg	UTSW	15	66696489	missense	probably benign	0.34
R1470:Tg	UTSW	15	66849463	missense	possibly damaging	0.95
R1470:Tg	UTSW	15	66849463	missense	possibly damaging	0.95
R1531:Tg	UTSW	15	66850502	missense	probably benign	0.02
R1544:Tg	UTSW	15	66705232	missense	probably benign	0.04
R1550:Tg	UTSW	15	66693430	missense	possibly damaging	0.52
R1575:Tg	UTSW	15	66729685	critical splice donor site	probably null
R1638:Tg	UTSW	15	66696166	nonsense	probably null
R1655:Tg	UTSW	15	66828568	critical splice donor site	probably null
R1671:Tg	UTSW	15	66692387	missense	possibly damaging	0.89
R1789:Tg	UTSW	15	66737548	missense	probably benign	0.00
R1883:Tg	UTSW	15	66671309	missense	probably damaging	1.00
R1984:Tg	UTSW	15	66682842	missense	probably benign
R2063:Tg	UTSW	15	66828553	missense	probably damaging	1.00
R2092:Tg	UTSW	15	66849607	missense	probably null	0.26
R2109:Tg	UTSW	15	66729594	missense	probably benign	0.02
R2128:Tg	UTSW	15	66694894	missense	probably benign	0.10
R2129:Tg	UTSW	15	66694894	missense	probably benign	0.10
R2207:Tg	UTSW	15	66681939	missense	probably benign	0.15
R2219:Tg	UTSW	15	66681933	missense	probably benign	0.03
R2228:Tg	UTSW	15	66674011	missense	probably damaging	0.99
R2229:Tg	UTSW	15	66674011	missense	probably damaging	0.99
R2259:Tg	UTSW	15	66683898	missense	probably benign
R2994:Tg	UTSW	15	66681953	missense	probably benign
R3904:Tg	UTSW	15	66766162	nonsense	probably null
R3946:Tg	UTSW	15	66674023	missense	probably damaging	1.00
R3965:Tg	UTSW	15	66684190	missense	probably benign
R4245:Tg	UTSW	15	66696469	missense	possibly damaging	0.68
R4451:Tg	UTSW	15	66766147	missense	probably benign	0.01
R4487:Tg	UTSW	15	66671396	missense	probably damaging	1.00
R4489:Tg	UTSW	15	66707942	missense	probably damaging	1.00
R4623:Tg	UTSW	15	66735271	missense	probably benign	0.23
R4659:Tg	UTSW	15	66673920	missense	possibly damaging	0.67
R4728:Tg	UTSW	15	66682827	missense	probably damaging	1.00
R4760:Tg	UTSW	15	66693319	missense	probably damaging	1.00
R4797:Tg	UTSW	15	66758006	critical splice donor site	probably null
R4944:Tg	UTSW	15	66764337	missense	probably damaging	1.00
R4998:Tg	UTSW	15	66674050	missense	probably damaging	1.00
R5009:Tg	UTSW	15	66696586	missense	probably benign	0.01
R5025:Tg	UTSW	15	66707930	missense	probably damaging	1.00
R5035:Tg	UTSW	15	66681813	splice site	probably null
R5049:Tg	UTSW	15	66827382	nonsense	probably null
R5073:Tg	UTSW	15	66735252	missense	probably benign	0.05
R5169:Tg	UTSW	15	66678780	nonsense	probably null
R5185:Tg	UTSW	15	66773474	missense	probably damaging	1.00
R5227:Tg	UTSW	15	66759567	missense	possibly damaging	0.87
R5300:Tg	UTSW	15	66678855	missense	probably damaging	1.00
R5334:Tg	UTSW	15	66678055	missense	probably damaging	1.00
R5339:Tg	UTSW	15	66678093	missense	probably damaging	1.00
R5402:Tg	UTSW	15	66739168	missense	probably damaging	0.98
R5441:Tg	UTSW	15	66696520	missense	possibly damaging	0.47
R5509:Tg	UTSW	15	66827293	missense	probably benign	0.45
R5580:Tg	UTSW	15	66685300	missense	possibly damaging	0.66
R5582:Tg	UTSW	15	66693435	missense	probably damaging	1.00
R5624:Tg	UTSW	15	66838057	missense	probably benign	0.11
R5686:Tg	UTSW	15	66688889	missense	probably benign	0.28
R6042:Tg	UTSW	15	66683993	missense	probably benign	0.01
R6122:Tg	UTSW	15	66828457	missense	probably damaging	1.00
R6146:Tg	UTSW	15	66673367	splice site	probably null
R6159:Tg	UTSW	15	66735247	missense	possibly damaging	0.71
R6223:Tg	UTSW	15	66707922	missense	probably benign	0.15
R6480:Tg	UTSW	15	66671311	missense	probably damaging	1.00
R6505:Tg	UTSW	15	66759558	missense	probably damaging	0.99
R6531:Tg	UTSW	15	66839362	missense	probably damaging	0.99
R6614:Tg	UTSW	15	66735259	missense	probably damaging	0.99
R6698:Tg	UTSW	15	66839362	missense	probably damaging	1.00
R6798:Tg	UTSW	15	66678839	missense	probably damaging	1.00
R6837:Tg	UTSW	15	66696135	missense	probably damaging	1.00
R6861:Tg	UTSW	15	66688891	missense	probably benign	0.00
R6888:Tg	UTSW	15	66696246	missense	probably damaging	0.99
R6933:Tg	UTSW	15	66764309	missense	possibly damaging	0.73
R6983:Tg	UTSW	15	66693358	missense	probably benign	0.01
R7078:Tg	UTSW	15	66673543	missense	probably damaging	1.00
R7244:Tg	UTSW	15	66740714	missense	probably damaging	1.00
R7320:Tg	UTSW	15	66694784	missense	possibly damaging	0.71
R7334:Tg	UTSW	15	66725272	missense	probably benign	0.01
R7418:Tg	UTSW	15	66696583	missense	probably damaging	0.99
R7485:Tg	UTSW	15	66696588	missense	probably benign	0.04
R7524:Tg	UTSW	15	66696161	missense	probably benign	0.01
R7529:Tg	UTSW	15	66694768	missense	probably damaging	0.99
R7540:Tg	UTSW	15	66689927	missense	probably benign	0.16
R7583:Tg	UTSW	15	66764418	missense	probably damaging	1.00
R7594:Tg	UTSW	15	66729583	missense	probably benign	0.20
R7667:Tg	UTSW	15	66715163	missense	probably damaging	0.98
R7722:Tg	UTSW	15	66764309	missense	possibly damaging	0.73
R7790:Tg	UTSW	15	66849604	missense	probably damaging	0.99
R7838:Tg	UTSW	15	66693263	missense	probably benign	0.00
R7890:Tg	UTSW	15	66683814	missense	probably damaging	1.00
R7904:Tg	UTSW	15	66705279	missense	probably benign	0.08
R7919:Tg	UTSW	15	66684074	missense	possibly damaging	0.73
R7921:Tg	UTSW	15	66683793	missense	probably benign	0.08
R8037:Tg	UTSW	15	66688875	missense	probably benign	0.00
R8038:Tg	UTSW	15	66688875	missense	probably benign	0.00
R8214:Tg	UTSW	15	66773398	missense	probably damaging	1.00
R8688:Tg	UTSW	15	66694953	critical splice donor site	probably benign
R8709:Tg	UTSW	15	66681937	missense	probably benign	0.08
R8714:Tg	UTSW	15	66684042	missense	probably damaging	0.97
R8901:Tg	UTSW	15	66685335	missense	probably damaging	1.00
R8917:Tg	UTSW	15	66773483	critical splice donor site	probably null
R9023:Tg	UTSW	15	66683673	missense	probably damaging	1.00
R9232:Tg	UTSW	15	66698461	missense	probably benign	0.01
R9310:Tg	UTSW	15	66827269	missense	possibly damaging	0.69
R9361:Tg	UTSW	15	66685397	missense	possibly damaging	0.50
R9389:Tg	UTSW	15	66689324	missense	probably benign	0.04
R9501:Tg	UTSW	15	66847074	missense	possibly damaging	0.52
R9510:Tg	UTSW	15	66674064	missense	probably damaging	1.00
R9594:Tg	UTSW	15	66735260	nonsense	probably null
R9629:Tg	UTSW	15	66683738	missense	possibly damaging	0.95
R9701:Tg	UTSW	15	66766142	missense	probably benign	0.03
R9743:Tg	UTSW	15	66689990	missense	probably benign	0.18
R9748:Tg	UTSW	15	66847159	missense	possibly damaging	0.91
T0975:Tg	UTSW	15	66688863	missense	probably benign	0.01
X0005:Tg	UTSW	15	66688863	missense	probably benign	0.01
X0065:Tg	UTSW	15	66682454	missense	probably damaging	1.00
X0067:Tg	UTSW	15	66748743	missense	probably benign	0.10
Z1177:Tg	UTSW	15	66685310	missense	possibly damaging	0.49
Z1177:Tg	UTSW	15	66849547	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TGAAATCTCCTGAGAGGGTCTG -3'
(R):5'- AGTACCTCCAGCAGTTCAAGAC -3'

Sequencing Primer
(F):5'- TCTGAGGCCTTCCAGGGTAG -3'
(R):5'- AGACTTACTTTCACAGGCAGGCTG -3'

Posted On

2020-07-28