Incidental Mutation 'R8304:Tg'
ID 639411
Institutional Source Beutler Lab
Gene Symbol Tg
Ensembl Gene ENSMUSG00000053469
Gene Name thyroglobulin
Synonyms Tgn
MMRRC Submission 067791-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R8304 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 66542606-66722570 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 66565109 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 1150 (C1150*)
Ref Sequence ENSEMBL: ENSMUSP00000070239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065916] [ENSMUST00000163495]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000065916
AA Change: C1150*
SMART Domains Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469
AA Change: C1150*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TY 50 97 5.9e-16 SMART
TY 118 165 5.59e-17 SMART
Pfam:Thyroglobulin_1 174 252 4e-9 PFAM
TY 317 363 4.36e-19 SMART
low complexity region 495 504 N/A INTRINSIC
TY 617 662 3.58e-15 SMART
TY 684 730 1.47e-16 SMART
TY 880 926 1.51e-4 SMART
TY 1029 1078 1.21e-12 SMART
TY 1106 1150 7.56e-5 SMART
TY 1167 1215 7.26e-16 SMART
low complexity region 1244 1255 N/A INTRINSIC
Pfam:GCC2_GCC3 1464 1509 2.7e-16 PFAM
TY 1519 1568 9.81e-13 SMART
Pfam:COesterase 2181 2717 8.4e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163495
SMART Domains Protein: ENSMUSP00000129868
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
TY 14 63 1.21e-12 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 109,997,954 (GRCm39) probably null Het
Akap11 T C 14: 78,750,672 (GRCm39) T572A Het
Amigo2 A T 15: 97,144,038 (GRCm39) L128Q probably damaging Het
Ankrd12 A G 17: 66,291,542 (GRCm39) I1297T possibly damaging Het
Arhgap32 T A 9: 32,167,233 (GRCm39) C623* probably null Het
Armc2 T C 10: 41,823,935 (GRCm39) Y511C probably damaging Het
Asb15 C T 6: 24,559,296 (GRCm39) P147L possibly damaging Het
Caprin1 G T 2: 103,599,862 (GRCm39) N604K probably damaging Het
Ccnl2 T C 4: 155,897,679 (GRCm39) F113L probably benign Het
Cltc C T 11: 86,616,087 (GRCm39) R393H probably benign Het
Cul4a G A 8: 13,177,727 (GRCm39) C289Y possibly damaging Het
Cyp4a29 T A 4: 115,111,653 (GRCm39) F477I probably damaging Het
Dapk2 C T 9: 66,139,027 (GRCm39) A116V possibly damaging Het
Ddx60 T C 8: 62,451,803 (GRCm39) I1231T possibly damaging Het
Eif5b A G 1: 38,084,774 (GRCm39) I874V probably benign Het
Eral1 A T 11: 77,966,828 (GRCm39) S196T probably damaging Het
Erc2 T G 14: 27,375,122 (GRCm39) D113E probably damaging Het
Frmpd2 A G 14: 33,274,066 (GRCm39) I1103V possibly damaging Het
Galm A G 17: 80,490,766 (GRCm39) T308A probably damaging Het
Helz2 A T 2: 180,871,950 (GRCm39) N2650K probably benign Het
Herc2 A G 7: 55,809,186 (GRCm39) D2562G probably damaging Het
Hmmr G A 11: 40,612,499 (GRCm39) S206F probably damaging Het
Hspbap1 T A 16: 35,607,695 (GRCm39) L67* probably null Het
Irx3 T A 8: 92,526,834 (GRCm39) D290V probably damaging Het
Kcns1 A T 2: 164,010,022 (GRCm39) Y246N probably damaging Het
Kidins220 A G 12: 25,107,127 (GRCm39) T1557A probably benign Het
Lrriq1 T C 10: 103,069,929 (GRCm39) N29S possibly damaging Het
Mmp24 T C 2: 155,641,759 (GRCm39) F196L possibly damaging Het
Mroh2b T C 15: 4,955,119 (GRCm39) V704A probably damaging Het
Mst1 A G 9: 107,958,803 (GRCm39) M112V probably benign Het
Myh8 C A 11: 67,195,162 (GRCm39) H1659N possibly damaging Het
Nlgn1 C T 3: 26,187,534 (GRCm39) C117Y probably damaging Het
Opa1 C T 16: 29,416,489 (GRCm39) T237M possibly damaging Het
Or2r2 C T 6: 42,463,672 (GRCm39) V152I probably benign Het
Or51f5 A G 7: 102,423,917 (GRCm39) Y62C possibly damaging Het
Or5v1 A T 17: 37,810,261 (GRCm39) T240S probably damaging Het
Or8b57 A T 9: 40,003,650 (GRCm39) I204N probably damaging Het
P3h1 C T 4: 119,104,402 (GRCm39) T641M probably damaging Het
Pak5 T C 2: 135,940,203 (GRCm39) H537R probably benign Het
Ppp1r12b A T 1: 134,824,101 (GRCm39) L174Q possibly damaging Het
Prkg1 A G 19: 30,701,584 (GRCm39) V326A possibly damaging Het
Psmb3 T A 11: 97,601,995 (GRCm39) C122S probably benign Het
Sh3bgrl3 C A 4: 133,855,312 (GRCm39) A45S probably benign Het
Slc25a47 T C 12: 108,821,868 (GRCm39) V219A possibly damaging Het
Slfn9 A C 11: 82,873,605 (GRCm39) S433A probably benign Het
Spata13 A T 14: 60,993,957 (GRCm39) R1136S possibly damaging Het
Stab1 C A 14: 30,870,911 (GRCm39) A1313S probably benign Het
Stim1 G A 7: 102,084,688 (GRCm39) A547T possibly damaging Het
Taf5l A T 8: 124,730,251 (GRCm39) I146N probably benign Het
Tbc1d12 A T 19: 38,825,824 (GRCm39) E225V possibly damaging Het
Tesc T C 5: 118,194,495 (GRCm39) Y135H probably benign Het
Tfg T C 16: 56,521,581 (GRCm39) E145G possibly damaging Het
Tmtc1 T C 6: 148,172,883 (GRCm39) N616S probably damaging Het
Trpm7 A T 2: 126,639,797 (GRCm39) W1600R probably damaging Het
Ttc17 A T 2: 94,199,526 (GRCm39) probably benign Het
Zfand1 A T 3: 10,413,615 (GRCm39) L24* probably null Het
Zfp282 AGCGGCGGCGGCGGCGGC AGCGGCGGCGGCGGC 6: 47,881,722 (GRCm39) probably benign Het
Zfp770 A C 2: 114,027,891 (GRCm39) F59L probably damaging Het
Other mutations in Tg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Tg APN 15 66,719,015 (GRCm39) missense probably damaging 1.00
IGL00230:Tg APN 15 66,699,139 (GRCm39) missense probably benign 0.00
IGL00324:Tg APN 15 66,565,273 (GRCm39) missense probably benign
IGL00428:Tg APN 15 66,645,273 (GRCm39) missense probably benign 0.33
IGL00703:Tg APN 15 66,568,338 (GRCm39) missense probably benign 0.34
IGL00808:Tg APN 15 66,555,662 (GRCm39) missense probably damaging 1.00
IGL00833:Tg APN 15 66,560,650 (GRCm39) missense probably benign 0.34
IGL00899:Tg APN 15 66,545,922 (GRCm39) critical splice donor site probably null
IGL00921:Tg APN 15 66,636,302 (GRCm39) missense probably benign 0.28
IGL00975:Tg APN 15 66,553,731 (GRCm39) missense probably benign
IGL01288:Tg APN 15 66,608,125 (GRCm39) missense possibly damaging 0.81
IGL01397:Tg APN 15 66,567,941 (GRCm39) splice site probably benign
IGL01634:Tg APN 15 66,601,415 (GRCm39) missense probably benign 0.34
IGL01646:Tg APN 15 66,549,936 (GRCm39) missense probably damaging 1.00
IGL01704:Tg APN 15 66,543,200 (GRCm39) missense probably damaging 0.98
IGL01958:Tg APN 15 66,631,335 (GRCm39) missense probably benign 0.06
IGL02093:Tg APN 15 66,564,223 (GRCm39) missense possibly damaging 0.83
IGL02113:Tg APN 15 66,577,179 (GRCm39) missense probably benign 0.08
IGL02138:Tg APN 15 66,589,082 (GRCm39) missense probably benign 0.01
IGL02156:Tg APN 15 66,577,197 (GRCm39) missense probably benign 0.19
IGL02169:Tg APN 15 66,629,792 (GRCm39) missense probably benign 0.04
IGL02342:Tg APN 15 66,636,140 (GRCm39) missense probably benign
IGL02434:Tg APN 15 66,636,191 (GRCm39) missense probably damaging 0.97
IGL02506:Tg APN 15 66,613,443 (GRCm39) missense possibly damaging 0.71
IGL02513:Tg APN 15 66,577,123 (GRCm39) missense probably benign
IGL02549:Tg APN 15 66,711,210 (GRCm39) missense probably damaging 1.00
IGL02669:Tg APN 15 66,620,575 (GRCm39) splice site probably benign
IGL02756:Tg APN 15 66,606,435 (GRCm39) missense probably benign
IGL02800:Tg APN 15 66,629,735 (GRCm39) missense probably damaging 1.00
IGL02828:Tg APN 15 66,554,243 (GRCm39) missense probably damaging 1.00
IGL02927:Tg APN 15 66,549,942 (GRCm39) missense probably damaging 1.00
IGL03061:Tg APN 15 66,543,254 (GRCm39) missense probably damaging 1.00
IGL03105:Tg APN 15 66,586,955 (GRCm39) missense probably benign 0.01
IGL03160:Tg APN 15 66,711,152 (GRCm39) nonsense probably null
IGL03242:Tg APN 15 66,555,647 (GRCm39) missense probably damaging 0.99
Also_ran UTSW 15 66,550,688 (GRCm39) missense probably damaging 1.00
bedraggled UTSW 15 66,612,563 (GRCm39) missense probably damaging 1.00
foster UTSW 15 66,565,109 (GRCm39) nonsense probably null
hognose UTSW 15 66,589,057 (GRCm39) missense probably damaging 0.99
ito UTSW 15 66,638,011 (GRCm39) nonsense probably null
ito2 UTSW 15 66,543,245 (GRCm39) missense probably damaging 1.00
ito3 UTSW 15 66,645,323 (GRCm39) missense probably damaging 1.00
ito4 UTSW 15 66,568,369 (GRCm39) missense possibly damaging 0.47
Papua UTSW 15 66,545,899 (GRCm39) missense probably damaging 1.00
Pipistrella UTSW 15 66,567,984 (GRCm39) missense probably damaging 1.00
pluribus UTSW 15 66,587,012 (GRCm39) missense probably damaging 0.98
samarai UTSW 15 66,629,855 (GRCm39) critical splice donor site probably null
sariba UTSW 15 66,566,719 (GRCm39) missense probably benign 0.01
ticker UTSW 15 66,699,231 (GRCm39) nonsense probably null
Vampire UTSW 15 66,554,676 (GRCm39) missense probably damaging 1.00
IGL03134:Tg UTSW 15 66,612,567 (GRCm39) missense probably damaging 1.00
P0019:Tg UTSW 15 66,560,712 (GRCm39) missense probably benign 0.01
R0121:Tg UTSW 15 66,612,630 (GRCm39) missense probably benign 0.04
R0135:Tg UTSW 15 66,566,719 (GRCm39) missense probably benign 0.01
R0227:Tg UTSW 15 66,570,295 (GRCm39) missense possibly damaging 0.84
R0448:Tg UTSW 15 66,636,291 (GRCm39) missense probably damaging 1.00
R0453:Tg UTSW 15 66,700,382 (GRCm39) missense probably benign 0.09
R0504:Tg UTSW 15 66,554,253 (GRCm39) missense probably damaging 0.97
R0543:Tg UTSW 15 66,601,446 (GRCm39) missense probably benign 0.13
R0638:Tg UTSW 15 66,589,057 (GRCm39) missense probably damaging 0.99
R0639:Tg UTSW 15 66,613,333 (GRCm39) critical splice acceptor site probably null
R0646:Tg UTSW 15 66,601,475 (GRCm39) missense probably damaging 0.99
R0666:Tg UTSW 15 66,609,370 (GRCm39) missense probably benign
R0673:Tg UTSW 15 66,613,333 (GRCm39) critical splice acceptor site probably null
R0689:Tg UTSW 15 66,711,253 (GRCm39) splice site probably benign
R0704:Tg UTSW 15 66,629,729 (GRCm39) missense probably benign 0.02
R0730:Tg UTSW 15 66,550,638 (GRCm39) missense probably damaging 1.00
R0830:Tg UTSW 15 66,596,993 (GRCm39) missense probably damaging 1.00
R0959:Tg UTSW 15 66,579,859 (GRCm39) missense probably damaging 0.98
R1027:Tg UTSW 15 66,544,258 (GRCm39) missense possibly damaging 0.65
R1061:Tg UTSW 15 66,570,408 (GRCm39) missense probably benign 0.09
R1086:Tg UTSW 15 66,555,911 (GRCm39) missense probably benign
R1103:Tg UTSW 15 66,591,504 (GRCm39) missense probably benign 0.45
R1240:Tg UTSW 15 66,700,397 (GRCm39) missense probably benign 0.16
R1281:Tg UTSW 15 66,568,338 (GRCm39) missense probably benign 0.34
R1470:Tg UTSW 15 66,721,312 (GRCm39) missense possibly damaging 0.95
R1470:Tg UTSW 15 66,721,312 (GRCm39) missense possibly damaging 0.95
R1531:Tg UTSW 15 66,722,351 (GRCm39) missense probably benign 0.02
R1544:Tg UTSW 15 66,577,081 (GRCm39) missense probably benign 0.04
R1550:Tg UTSW 15 66,565,279 (GRCm39) missense possibly damaging 0.52
R1575:Tg UTSW 15 66,601,534 (GRCm39) critical splice donor site probably null
R1638:Tg UTSW 15 66,568,015 (GRCm39) nonsense probably null
R1655:Tg UTSW 15 66,700,417 (GRCm39) critical splice donor site probably null
R1671:Tg UTSW 15 66,564,236 (GRCm39) missense possibly damaging 0.89
R1789:Tg UTSW 15 66,609,397 (GRCm39) missense probably benign 0.00
R1883:Tg UTSW 15 66,543,158 (GRCm39) missense probably damaging 1.00
R1984:Tg UTSW 15 66,554,691 (GRCm39) missense probably benign
R2063:Tg UTSW 15 66,700,402 (GRCm39) missense probably damaging 1.00
R2092:Tg UTSW 15 66,721,456 (GRCm39) missense probably null 0.26
R2109:Tg UTSW 15 66,601,443 (GRCm39) missense probably benign 0.02
R2128:Tg UTSW 15 66,566,743 (GRCm39) missense probably benign 0.10
R2129:Tg UTSW 15 66,566,743 (GRCm39) missense probably benign 0.10
R2207:Tg UTSW 15 66,553,788 (GRCm39) missense probably benign 0.15
R2219:Tg UTSW 15 66,553,782 (GRCm39) missense probably benign 0.03
R2228:Tg UTSW 15 66,545,860 (GRCm39) missense probably damaging 0.99
R2229:Tg UTSW 15 66,545,860 (GRCm39) missense probably damaging 0.99
R2259:Tg UTSW 15 66,555,747 (GRCm39) missense probably benign
R2994:Tg UTSW 15 66,553,802 (GRCm39) missense probably benign
R3904:Tg UTSW 15 66,638,011 (GRCm39) nonsense probably null
R3946:Tg UTSW 15 66,545,872 (GRCm39) missense probably damaging 1.00
R3965:Tg UTSW 15 66,556,039 (GRCm39) missense probably benign
R4245:Tg UTSW 15 66,568,318 (GRCm39) missense possibly damaging 0.68
R4451:Tg UTSW 15 66,637,996 (GRCm39) missense probably benign 0.01
R4487:Tg UTSW 15 66,543,245 (GRCm39) missense probably damaging 1.00
R4489:Tg UTSW 15 66,579,791 (GRCm39) missense probably damaging 1.00
R4623:Tg UTSW 15 66,607,120 (GRCm39) missense probably benign 0.23
R4659:Tg UTSW 15 66,545,769 (GRCm39) missense possibly damaging 0.67
R4728:Tg UTSW 15 66,554,676 (GRCm39) missense probably damaging 1.00
R4760:Tg UTSW 15 66,565,168 (GRCm39) missense probably damaging 1.00
R4797:Tg UTSW 15 66,629,855 (GRCm39) critical splice donor site probably null
R4944:Tg UTSW 15 66,636,186 (GRCm39) missense probably damaging 1.00
R4998:Tg UTSW 15 66,545,899 (GRCm39) missense probably damaging 1.00
R5009:Tg UTSW 15 66,568,435 (GRCm39) missense probably benign 0.01
R5025:Tg UTSW 15 66,579,779 (GRCm39) missense probably damaging 1.00
R5035:Tg UTSW 15 66,553,662 (GRCm39) splice site probably null
R5049:Tg UTSW 15 66,699,231 (GRCm39) nonsense probably null
R5073:Tg UTSW 15 66,607,101 (GRCm39) missense probably benign 0.05
R5169:Tg UTSW 15 66,550,629 (GRCm39) nonsense probably null
R5185:Tg UTSW 15 66,645,323 (GRCm39) missense probably damaging 1.00
R5227:Tg UTSW 15 66,631,416 (GRCm39) missense possibly damaging 0.87
R5300:Tg UTSW 15 66,550,704 (GRCm39) missense probably damaging 1.00
R5334:Tg UTSW 15 66,549,904 (GRCm39) missense probably damaging 1.00
R5339:Tg UTSW 15 66,549,942 (GRCm39) missense probably damaging 1.00
R5402:Tg UTSW 15 66,611,017 (GRCm39) missense probably damaging 0.98
R5441:Tg UTSW 15 66,568,369 (GRCm39) missense possibly damaging 0.47
R5509:Tg UTSW 15 66,699,142 (GRCm39) missense probably benign 0.45
R5580:Tg UTSW 15 66,557,149 (GRCm39) missense possibly damaging 0.66
R5582:Tg UTSW 15 66,565,284 (GRCm39) missense probably damaging 1.00
R5624:Tg UTSW 15 66,709,906 (GRCm39) missense probably benign 0.11
R5686:Tg UTSW 15 66,560,738 (GRCm39) missense probably benign 0.28
R6042:Tg UTSW 15 66,555,842 (GRCm39) missense probably benign 0.01
R6122:Tg UTSW 15 66,700,306 (GRCm39) missense probably damaging 1.00
R6146:Tg UTSW 15 66,545,216 (GRCm39) splice site probably null
R6159:Tg UTSW 15 66,607,096 (GRCm39) missense possibly damaging 0.71
R6223:Tg UTSW 15 66,579,771 (GRCm39) missense probably benign 0.15
R6480:Tg UTSW 15 66,543,160 (GRCm39) missense probably damaging 1.00
R6505:Tg UTSW 15 66,631,407 (GRCm39) missense probably damaging 0.99
R6531:Tg UTSW 15 66,711,211 (GRCm39) missense probably damaging 0.99
R6614:Tg UTSW 15 66,607,108 (GRCm39) missense probably damaging 0.99
R6698:Tg UTSW 15 66,711,211 (GRCm39) missense probably damaging 1.00
R6798:Tg UTSW 15 66,550,688 (GRCm39) missense probably damaging 1.00
R6837:Tg UTSW 15 66,567,984 (GRCm39) missense probably damaging 1.00
R6861:Tg UTSW 15 66,560,740 (GRCm39) missense probably benign 0.00
R6888:Tg UTSW 15 66,568,095 (GRCm39) missense probably damaging 0.99
R6933:Tg UTSW 15 66,636,158 (GRCm39) missense possibly damaging 0.73
R6983:Tg UTSW 15 66,565,207 (GRCm39) missense probably benign 0.01
R7078:Tg UTSW 15 66,545,392 (GRCm39) missense probably damaging 1.00
R7244:Tg UTSW 15 66,612,563 (GRCm39) missense probably damaging 1.00
R7320:Tg UTSW 15 66,566,633 (GRCm39) missense possibly damaging 0.71
R7334:Tg UTSW 15 66,597,121 (GRCm39) missense probably benign 0.01
R7418:Tg UTSW 15 66,568,432 (GRCm39) missense probably damaging 0.99
R7485:Tg UTSW 15 66,568,437 (GRCm39) missense probably benign 0.04
R7524:Tg UTSW 15 66,568,010 (GRCm39) missense probably benign 0.01
R7529:Tg UTSW 15 66,566,617 (GRCm39) missense probably damaging 0.99
R7540:Tg UTSW 15 66,561,776 (GRCm39) missense probably benign 0.16
R7583:Tg UTSW 15 66,636,267 (GRCm39) missense probably damaging 1.00
R7594:Tg UTSW 15 66,601,432 (GRCm39) missense probably benign 0.20
R7667:Tg UTSW 15 66,587,012 (GRCm39) missense probably damaging 0.98
R7722:Tg UTSW 15 66,636,158 (GRCm39) missense possibly damaging 0.73
R7790:Tg UTSW 15 66,721,453 (GRCm39) missense probably damaging 0.99
R7838:Tg UTSW 15 66,565,112 (GRCm39) missense probably benign 0.00
R7890:Tg UTSW 15 66,555,663 (GRCm39) missense probably damaging 1.00
R7904:Tg UTSW 15 66,577,128 (GRCm39) missense probably benign 0.08
R7919:Tg UTSW 15 66,555,923 (GRCm39) missense possibly damaging 0.73
R7921:Tg UTSW 15 66,555,642 (GRCm39) missense probably benign 0.08
R8037:Tg UTSW 15 66,560,724 (GRCm39) missense probably benign 0.00
R8038:Tg UTSW 15 66,560,724 (GRCm39) missense probably benign 0.00
R8214:Tg UTSW 15 66,645,247 (GRCm39) missense probably damaging 1.00
R8688:Tg UTSW 15 66,566,802 (GRCm39) critical splice donor site probably benign
R8709:Tg UTSW 15 66,553,786 (GRCm39) missense probably benign 0.08
R8714:Tg UTSW 15 66,555,891 (GRCm39) missense probably damaging 0.97
R8901:Tg UTSW 15 66,557,184 (GRCm39) missense probably damaging 1.00
R8917:Tg UTSW 15 66,645,332 (GRCm39) critical splice donor site probably null
R9023:Tg UTSW 15 66,555,522 (GRCm39) missense probably damaging 1.00
R9232:Tg UTSW 15 66,570,310 (GRCm39) missense probably benign 0.01
R9310:Tg UTSW 15 66,699,118 (GRCm39) missense possibly damaging 0.69
R9361:Tg UTSW 15 66,557,246 (GRCm39) missense possibly damaging 0.50
R9389:Tg UTSW 15 66,561,173 (GRCm39) missense probably benign 0.04
R9501:Tg UTSW 15 66,718,923 (GRCm39) missense possibly damaging 0.52
R9510:Tg UTSW 15 66,545,913 (GRCm39) missense probably damaging 1.00
R9594:Tg UTSW 15 66,607,109 (GRCm39) nonsense probably null
R9629:Tg UTSW 15 66,555,587 (GRCm39) missense possibly damaging 0.95
R9701:Tg UTSW 15 66,637,991 (GRCm39) missense probably benign 0.03
R9743:Tg UTSW 15 66,561,839 (GRCm39) missense probably benign 0.18
R9748:Tg UTSW 15 66,719,008 (GRCm39) missense possibly damaging 0.91
T0975:Tg UTSW 15 66,560,712 (GRCm39) missense probably benign 0.01
X0005:Tg UTSW 15 66,560,712 (GRCm39) missense probably benign 0.01
X0065:Tg UTSW 15 66,554,303 (GRCm39) missense probably damaging 1.00
X0067:Tg UTSW 15 66,620,592 (GRCm39) missense probably benign 0.10
Z1177:Tg UTSW 15 66,721,396 (GRCm39) missense probably benign 0.02
Z1177:Tg UTSW 15 66,557,159 (GRCm39) missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TGAAATCTCCTGAGAGGGTCTG -3'
(R):5'- AGTACCTCCAGCAGTTCAAGAC -3'

Sequencing Primer
(F):5'- TCTGAGGCCTTCCAGGGTAG -3'
(R):5'- AGACTTACTTTCACAGGCAGGCTG -3'
Posted On 2020-07-28