Mutagenetix > Incidental Mutation

Incidental Mutation 'R8304:Prkg1'

639419

Institutional Source

Beutler Lab

Gene Symbol

Prkg1

Ensembl Gene

ENSMUSG00000052920

Gene Name

protein kinase, cGMP-dependent, type I

Synonyms

Prkgr1b, Prkg1b

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.487) question?

Stock #

R8304 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30567551-31765033 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30724184 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 326 (V326A)

Ref Sequence

ENSEMBL: ENSMUSP00000073268 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065067] [ENSMUST00000073581]

AlphaFold

P0C605

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065067
AA Change: V311A

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000067576
Gene: ENSMUSG00000052920
AA Change: V311A

Domain	Start	End	E-Value	Type
coiled coil region	5	49	N/A	INTRINSIC
cNMP	103	216	6.37e-27	SMART
cNMP	221	343	1.23e-33	SMART
S_TKc	360	619	5.25e-91	SMART
S_TK_X	620	671	1.55e-10	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000073581
AA Change: V326A

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000073268
Gene: ENSMUSG00000052920
AA Change: V326A

Domain	Start	End	E-Value	Type
coiled coil region	10	62	N/A	INTRINSIC
cNMP	118	231	6.37e-27	SMART
cNMP	236	358	1.23e-33	SMART
S_TKc	375	634	5.25e-91	SMART
S_TK_X	635	686	1.55e-10	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammals have three different isoforms of cyclic GMP-dependent protein kinase (Ialpha, Ibeta, and II). These PRKG isoforms act as key mediators of the nitric oxide/cGMP signaling pathway and are important components of many signal transduction processes in diverse cell types. This PRKG1 gene on human chromosome 10 encodes the soluble Ialpha and Ibeta isoforms of PRKG by alternative transcript splicing. A separate gene on human chromosome 4, PRKG2, encodes the membrane-bound PRKG isoform II. The PRKG1 proteins play a central role in regulating cardiovascular and neuronal functions in addition to relaxing smooth muscle tone, preventing platelet aggregation, and modulating cell growth. This gene is most strongly expressed in all types of smooth muscle, platelets, cerebellar Purkinje cells, hippocampal neurons, and the lateral amygdala. Isoforms Ialpha and Ibeta have identical cGMP-binding and catalytic domains but differ in their leucine/isoleucine zipper and autoinhibitory sequences and therefore differ in their dimerization substrates and kinase enzyme activity. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice exhibit abnormal smooth muscle function and penile erectile deficiency. Conditional disruption in the hippocampus results in impaired LTP. Mice homozygous for a transposon induced allele exhibit postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	A	G	11: 110,107,128		probably null	Het
Akap11	T	C	14: 78,513,232	T572A		Het
Amigo2	A	T	15: 97,246,157	L128Q	probably damaging	Het
Ankrd12	A	G	17: 65,984,547	I1297T	possibly damaging	Het
Arhgap32	T	A	9: 32,255,937	C623*	probably null	Het
Armc2	T	C	10: 41,947,939	Y511C	probably damaging	Het
Asb15	C	T	6: 24,559,297	P147L	possibly damaging	Het
Caprin1	G	T	2: 103,769,517	N604K	probably damaging	Het
Ccnl2	T	C	4: 155,813,222	F113L	probably benign	Het
Cltc	C	T	11: 86,725,261	R393H	probably benign	Het
Cul4a	G	A	8: 13,127,727	C289Y	possibly damaging	Het
Cyp4a29	T	A	4: 115,254,456	F477I	probably damaging	Het
Dapk2	C	T	9: 66,231,745	A116V	possibly damaging	Het
Ddx60	T	C	8: 61,998,769	I1231T	possibly damaging	Het
Eif5b	A	G	1: 38,045,693	I874V	probably benign	Het
Eral1	A	T	11: 78,076,002	S196T	probably damaging	Het
Erc2	T	G	14: 27,653,165	D113E	probably damaging	Het
Frmpd2	A	G	14: 33,552,109	I1103V	possibly damaging	Het
Galm	A	G	17: 80,183,337	T308A	probably damaging	Het
Helz2	A	T	2: 181,230,157	N2650K	probably benign	Het
Herc2	A	G	7: 56,159,438	D2562G	probably damaging	Het
Hmmr	G	A	11: 40,721,672	S206F	probably damaging	Het
Hspbap1	T	A	16: 35,787,325	L67*	probably null	Het
Irx3	T	A	8: 91,800,206	D290V	probably damaging	Het
Kcns1	A	T	2: 164,168,102	Y246N	probably damaging	Het
Kidins220	A	G	12: 25,057,128	T1557A	probably benign	Het
Lrriq1	T	C	10: 103,234,068	N29S	possibly damaging	Het
Mmp24	T	C	2: 155,799,839	F196L	possibly damaging	Het
Mroh2b	T	C	15: 4,925,637	V704A	probably damaging	Het
Mst1	A	G	9: 108,081,604	M112V	probably benign	Het
Myh8	C	A	11: 67,304,336	H1659N	possibly damaging	Het
Nlgn1	C	T	3: 26,133,385	C117Y	probably damaging	Het
Olfr110	A	T	17: 37,499,370	T240S	probably damaging	Het
Olfr456	C	T	6: 42,486,738	V152I	probably benign	Het
Olfr561	A	G	7: 102,774,710	Y62C	possibly damaging	Het
Olfr983	A	T	9: 40,092,354	I204N	probably damaging	Het
Opa1	C	T	16: 29,597,671	T237M	possibly damaging	Het
P3h1	C	T	4: 119,247,205	T641M	probably damaging	Het
Pak7	T	C	2: 136,098,283	H537R	probably benign	Het
Ppp1r12b	A	T	1: 134,896,363	L174Q	possibly damaging	Het
Psmb3	T	A	11: 97,711,169	C122S	probably benign	Het
Sh3bgrl3	C	A	4: 134,128,001	A45S	probably benign	Het
Slc25a47	T	C	12: 108,855,942	V219A	possibly damaging	Het
Slfn9	A	C	11: 82,982,779	S433A	probably benign	Het
Spata13	A	T	14: 60,756,508	R1136S	possibly damaging	Het
Stab1	C	A	14: 31,148,954	A1313S	probably benign	Het
Stim1	G	A	7: 102,435,481	A547T	possibly damaging	Het
Taf5l	A	T	8: 124,003,512	I146N	probably benign	Het
Tbc1d12	A	T	19: 38,837,380	E225V	possibly damaging	Het
Tesc	T	C	5: 118,056,430	Y135H	probably benign	Het
Tfg	T	C	16: 56,701,218	E145G	possibly damaging	Het
Tg	T	A	15: 66,693,260	C1150*	probably null	Het
Tmtc1	T	C	6: 148,271,385	N616S	probably damaging	Het
Trpm7	A	T	2: 126,797,877	W1600R	probably damaging	Het
Ttc17	A	T	2: 94,369,181		probably benign	Het
Zfand1	A	T	3: 10,348,555	L24*	probably null	Het
Zfp282	AGCGGCGGCGGCGGCGGC	AGCGGCGGCGGCGGC	6: 47,904,788		probably benign	Het
Zfp770	A	C	2: 114,197,410	F59L	probably damaging	Het

Other mutations in Prkg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Prkg1	APN	19	31302340	missense	probably benign	0.02
IGL00481:Prkg1	APN	19	30571622	missense	probably benign	0.28
IGL00517:Prkg1	APN	19	30894668	missense	probably benign
IGL00782:Prkg1	APN	19	30578753	splice site	probably benign
IGL01070:Prkg1	APN	19	30569343	splice site	probably benign
IGL01106:Prkg1	APN	19	30585278	missense	probably benign	0.05
IGL01783:Prkg1	APN	19	30624689	missense	probably damaging	1.00
IGL02135:Prkg1	APN	19	30993076	missense	probably benign	0.13
IGL02492:Prkg1	APN	19	30724202	missense	probably damaging	1.00
IGL02543:Prkg1	APN	19	30624734	missense	possibly damaging	0.62
IGL02733:Prkg1	APN	19	31302301	missense	probably damaging	1.00
IGL03129:Prkg1	APN	19	30585281	nonsense	probably null
IGL03220:Prkg1	APN	19	30569237	utr 3 prime	probably benign
R0363:Prkg1	UTSW	19	31664196	missense	probably damaging	1.00
R0693:Prkg1	UTSW	19	30594978	missense	probably benign
R1099:Prkg1	UTSW	19	30571612	missense	probably benign
R1464:Prkg1	UTSW	19	30578870	missense	probably damaging	0.99
R1464:Prkg1	UTSW	19	30578870	missense	probably damaging	0.99
R1556:Prkg1	UTSW	19	30624743	missense	probably benign
R1738:Prkg1	UTSW	19	30786922	missense	possibly damaging	0.48
R1974:Prkg1	UTSW	19	31585695	missense	probably damaging	1.00
R2011:Prkg1	UTSW	19	31664142	missense	possibly damaging	0.94
R2207:Prkg1	UTSW	19	30578860	missense	probably damaging	1.00
R2270:Prkg1	UTSW	19	30578631	missense	probably benign	0.27
R3009:Prkg1	UTSW	19	31664112	missense	possibly damaging	0.74
R4078:Prkg1	UTSW	19	31585578	missense	probably damaging	1.00
R4355:Prkg1	UTSW	19	30569229	utr 3 prime	probably benign
R4652:Prkg1	UTSW	19	30595012	missense	probably damaging	1.00
R4669:Prkg1	UTSW	19	31664239	missense	probably damaging	0.98
R4684:Prkg1	UTSW	19	31664179	nonsense	probably null
R4789:Prkg1	UTSW	19	31585645	missense	probably damaging	0.97
R4826:Prkg1	UTSW	19	31764606	missense	possibly damaging	0.93
R4936:Prkg1	UTSW	19	30586375	missense	probably benign	0.37
R5625:Prkg1	UTSW	19	31764762	missense	possibly damaging	0.95
R5819:Prkg1	UTSW	19	31585672	missense	probably benign	0.02
R5855:Prkg1	UTSW	19	30894694	missense	possibly damaging	0.93
R5882:Prkg1	UTSW	19	31585697	missense	probably damaging	1.00
R5965:Prkg1	UTSW	19	30724156	splice site	probably null
R5968:Prkg1	UTSW	19	30592924	missense	probably damaging	1.00
R6310:Prkg1	UTSW	19	30569251	missense	probably damaging	1.00
R6433:Prkg1	UTSW	19	30781346	missense	probably benign	0.21
R6702:Prkg1	UTSW	19	30993084	missense	probably benign	0.00
R6750:Prkg1	UTSW	19	31764561	missense	probably benign	0.41
R6894:Prkg1	UTSW	19	30624774	nonsense	probably null
R7155:Prkg1	UTSW	19	31302301	missense	probably damaging	1.00
R7165:Prkg1	UTSW	19	30585199	missense	probably damaging	1.00
R7238:Prkg1	UTSW	19	30624690	missense	probably damaging	1.00
R7428:Prkg1	UTSW	19	30578835	missense	probably damaging	1.00
R7748:Prkg1	UTSW	19	30993091	missense	possibly damaging	0.90
R7804:Prkg1	UTSW	19	30578632	missense	probably benign	0.00
R7804:Prkg1	UTSW	19	30624770	missense	possibly damaging	0.92
R7893:Prkg1	UTSW	19	30586367	missense	probably damaging	0.99
R8497:Prkg1	UTSW	19	31302309	missense	probably damaging	1.00
R8676:Prkg1	UTSW	19	31764746	missense	probably damaging	0.98
R9318:Prkg1	UTSW	19	30571638	missense	probably benign	0.09
R9694:Prkg1	UTSW	19	30786971	missense	possibly damaging	0.84
X0011:Prkg1	UTSW	19	30993121	missense	probably damaging	1.00
Z1177:Prkg1	UTSW	19	31302373	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TAGATTGGCAGAACTAGCCAC -3'
(R):5'- GTGTAAAGTGGCTCTTCACAGG -3'

Sequencing Primer
(F):5'- GATTGGCAGAACTAGCCACTTCAAG -3'
(R):5'- CAGGAAGTGTAAACCTGGAGG -3'

Posted On

2020-07-28