Incidental Mutation 'R8304:Prkg1'
ID639419
Institutional Source Beutler Lab
Gene Symbol Prkg1
Ensembl Gene ENSMUSG00000052920
Gene Nameprotein kinase, cGMP-dependent, type I
SynonymsPrkgr1b, Prkg1b
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.635) question?
Stock #R8304 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location30567551-31765033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30724184 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 326 (V326A)
Ref Sequence ENSEMBL: ENSMUSP00000073268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065067] [ENSMUST00000073581]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065067
AA Change: V311A

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067576
Gene: ENSMUSG00000052920
AA Change: V311A

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
cNMP 103 216 6.37e-27 SMART
cNMP 221 343 1.23e-33 SMART
S_TKc 360 619 5.25e-91 SMART
S_TK_X 620 671 1.55e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000073581
AA Change: V326A

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000073268
Gene: ENSMUSG00000052920
AA Change: V326A

DomainStartEndE-ValueType
coiled coil region 10 62 N/A INTRINSIC
cNMP 118 231 6.37e-27 SMART
cNMP 236 358 1.23e-33 SMART
S_TKc 375 634 5.25e-91 SMART
S_TK_X 635 686 1.55e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammals have three different isoforms of cyclic GMP-dependent protein kinase (Ialpha, Ibeta, and II). These PRKG isoforms act as key mediators of the nitric oxide/cGMP signaling pathway and are important components of many signal transduction processes in diverse cell types. This PRKG1 gene on human chromosome 10 encodes the soluble Ialpha and Ibeta isoforms of PRKG by alternative transcript splicing. A separate gene on human chromosome 4, PRKG2, encodes the membrane-bound PRKG isoform II. The PRKG1 proteins play a central role in regulating cardiovascular and neuronal functions in addition to relaxing smooth muscle tone, preventing platelet aggregation, and modulating cell growth. This gene is most strongly expressed in all types of smooth muscle, platelets, cerebellar Purkinje cells, hippocampal neurons, and the lateral amygdala. Isoforms Ialpha and Ibeta have identical cGMP-binding and catalytic domains but differ in their leucine/isoleucine zipper and autoinhibitory sequences and therefore differ in their dimerization substrates and kinase enzyme activity. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice exhibit abnormal smooth muscle function and penile erectile deficiency. Conditional disruption in the hippocampus results in impaired LTP. Mice homozygous for a transposon induced allele exhibit postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 A G 11: 110,107,128 probably null Het
Akap11 T C 14: 78,513,232 T572A Het
Amigo2 A T 15: 97,246,157 L128Q probably damaging Het
Ankrd12 A G 17: 65,984,547 I1297T possibly damaging Het
Arhgap32 T A 9: 32,255,937 C623* probably null Het
Armc2 T C 10: 41,947,939 Y511C probably damaging Het
Asb15 C T 6: 24,559,297 P147L possibly damaging Het
Caprin1 G T 2: 103,769,517 N604K probably damaging Het
Ccnl2 T C 4: 155,813,222 F113L probably benign Het
Cltc C T 11: 86,725,261 R393H probably benign Het
Cul4a G A 8: 13,127,727 C289Y possibly damaging Het
Cyp4a29 T A 4: 115,254,456 F477I probably damaging Het
Dapk2 C T 9: 66,231,745 A116V possibly damaging Het
Ddx60 T C 8: 61,998,769 I1231T possibly damaging Het
Eif5b A G 1: 38,045,693 I874V probably benign Het
Eral1 A T 11: 78,076,002 S196T probably damaging Het
Erc2 T G 14: 27,653,165 D113E probably damaging Het
Galm A G 17: 80,183,337 T308A probably damaging Het
Gm626 A G 14: 33,552,109 I1103V possibly damaging Het
Helz2 A T 2: 181,230,157 N2650K probably benign Het
Herc2 A G 7: 56,159,438 D2562G probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Hspbap1 T A 16: 35,787,325 L67* probably null Het
Irx3 T A 8: 91,800,206 D290V probably damaging Het
Kcns1 A T 2: 164,168,102 Y246N probably damaging Het
Kidins220 A G 12: 25,057,128 T1557A probably benign Het
Lrriq1 T C 10: 103,234,068 N29S possibly damaging Het
Mmp24 T C 2: 155,799,839 F196L possibly damaging Het
Mroh2b T C 15: 4,925,637 V704A probably damaging Het
Mst1 A G 9: 108,081,604 M112V probably benign Het
Myh8 C A 11: 67,304,336 H1659N possibly damaging Het
Nlgn1 C T 3: 26,133,385 C117Y probably damaging Het
Olfr110 A T 17: 37,499,370 T240S probably damaging Het
Olfr456 C T 6: 42,486,738 V152I probably benign Het
Olfr561 A G 7: 102,774,710 Y62C possibly damaging Het
Olfr983 A T 9: 40,092,354 I204N probably damaging Het
Opa1 C T 16: 29,597,671 T237M possibly damaging Het
P3h1 C T 4: 119,247,205 T641M probably damaging Het
Pak7 T C 2: 136,098,283 H537R probably benign Het
Ppp1r12b A T 1: 134,896,363 L174Q possibly damaging Het
Psmb3 T A 11: 97,711,169 C122S probably benign Het
Sh3bgrl3 C A 4: 134,128,001 A45S probably benign Het
Slc25a47 T C 12: 108,855,942 V219A possibly damaging Het
Slfn9 A C 11: 82,982,779 S433A probably benign Het
Spata13 A T 14: 60,756,508 R1136S possibly damaging Het
Stab1 C A 14: 31,148,954 A1313S probably benign Het
Stim1 G A 7: 102,435,481 A547T possibly damaging Het
Taf5l A T 8: 124,003,512 I146N probably benign Het
Tbc1d12 A T 19: 38,837,380 E225V possibly damaging Het
Tesc T C 5: 118,056,430 Y135H probably benign Het
Tfg T C 16: 56,701,218 E145G possibly damaging Het
Tg T A 15: 66,693,260 C1150* probably null Het
Tmtc1 T C 6: 148,271,385 N616S probably damaging Het
Trpm7 A T 2: 126,797,877 W1600R probably damaging Het
Zfand1 A T 3: 10,348,555 L24* probably null Het
Zfp282 AGCGGCGGCGGCGGCGGC AGCGGCGGCGGCGGC 6: 47,904,788 probably benign Het
Zfp770 A C 2: 114,197,410 F59L probably damaging Het
Other mutations in Prkg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Prkg1 APN 19 31302340 missense probably benign 0.02
IGL00481:Prkg1 APN 19 30571622 missense probably benign 0.28
IGL00517:Prkg1 APN 19 30894668 missense probably benign
IGL00782:Prkg1 APN 19 30578753 splice site probably benign
IGL01070:Prkg1 APN 19 30569343 splice site probably benign
IGL01106:Prkg1 APN 19 30585278 missense probably benign 0.05
IGL01783:Prkg1 APN 19 30624689 missense probably damaging 1.00
IGL02135:Prkg1 APN 19 30993076 missense probably benign 0.13
IGL02492:Prkg1 APN 19 30724202 missense probably damaging 1.00
IGL02543:Prkg1 APN 19 30624734 missense possibly damaging 0.62
IGL02733:Prkg1 APN 19 31302301 missense probably damaging 1.00
IGL03129:Prkg1 APN 19 30585281 nonsense probably null
IGL03220:Prkg1 APN 19 30569237 utr 3 prime probably benign
R0363:Prkg1 UTSW 19 31664196 missense probably damaging 1.00
R0693:Prkg1 UTSW 19 30594978 missense probably benign
R1099:Prkg1 UTSW 19 30571612 missense probably benign
R1464:Prkg1 UTSW 19 30578870 missense probably damaging 0.99
R1464:Prkg1 UTSW 19 30578870 missense probably damaging 0.99
R1556:Prkg1 UTSW 19 30624743 missense probably benign
R1738:Prkg1 UTSW 19 30786922 missense possibly damaging 0.48
R1974:Prkg1 UTSW 19 31585695 missense probably damaging 1.00
R2011:Prkg1 UTSW 19 31664142 missense possibly damaging 0.94
R2207:Prkg1 UTSW 19 30578860 missense probably damaging 1.00
R2270:Prkg1 UTSW 19 30578631 missense probably benign 0.27
R3009:Prkg1 UTSW 19 31664112 missense possibly damaging 0.74
R4078:Prkg1 UTSW 19 31585578 missense probably damaging 1.00
R4355:Prkg1 UTSW 19 30569229 utr 3 prime probably benign
R4652:Prkg1 UTSW 19 30595012 missense probably damaging 1.00
R4669:Prkg1 UTSW 19 31664239 missense probably damaging 0.98
R4684:Prkg1 UTSW 19 31664179 nonsense probably null
R4789:Prkg1 UTSW 19 31585645 missense probably damaging 0.97
R4826:Prkg1 UTSW 19 31764606 missense possibly damaging 0.93
R4936:Prkg1 UTSW 19 30586375 missense probably benign 0.37
R5625:Prkg1 UTSW 19 31764762 missense possibly damaging 0.95
R5819:Prkg1 UTSW 19 31585672 missense probably benign 0.02
R5855:Prkg1 UTSW 19 30894694 missense possibly damaging 0.93
R5882:Prkg1 UTSW 19 31585697 missense probably damaging 1.00
R5965:Prkg1 UTSW 19 30724156 splice site probably null
R5968:Prkg1 UTSW 19 30592924 missense probably damaging 1.00
R6310:Prkg1 UTSW 19 30569251 missense probably damaging 1.00
R6433:Prkg1 UTSW 19 30781346 missense probably benign 0.21
R6702:Prkg1 UTSW 19 30993084 missense probably benign 0.00
R6750:Prkg1 UTSW 19 31764561 missense probably benign 0.41
R6894:Prkg1 UTSW 19 30624774 nonsense probably null
R7155:Prkg1 UTSW 19 31302301 missense probably damaging 1.00
R7165:Prkg1 UTSW 19 30585199 missense probably damaging 1.00
R7238:Prkg1 UTSW 19 30624690 missense probably damaging 1.00
R7428:Prkg1 UTSW 19 30578835 missense probably damaging 1.00
R7748:Prkg1 UTSW 19 30993091 missense possibly damaging 0.90
R7804:Prkg1 UTSW 19 30578632 missense probably benign 0.00
R7804:Prkg1 UTSW 19 30624770 missense possibly damaging 0.92
R7893:Prkg1 UTSW 19 30586367 missense probably damaging 0.99
X0011:Prkg1 UTSW 19 30993121 missense probably damaging 1.00
Z1177:Prkg1 UTSW 19 31302373 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TAGATTGGCAGAACTAGCCAC -3'
(R):5'- GTGTAAAGTGGCTCTTCACAGG -3'

Sequencing Primer
(F):5'- GATTGGCAGAACTAGCCACTTCAAG -3'
(R):5'- CAGGAAGTGTAAACCTGGAGG -3'
Posted On2020-07-28