Incidental Mutation 'R8270:Ctse'
ID639421
Institutional Source Beutler Lab
Gene Symbol Ctse
Ensembl Gene ENSMUSG00000004552
Gene Namecathepsin E
SynonymsCatE, C920004C08Rik, CE, A430072O03Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8270 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location131638306-131675505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131668139 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 190 (Y190H)
Ref Sequence ENSEMBL: ENSMUSP00000073072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073350] [ENSMUST00000112411]
Predicted Effect probably damaging
Transcript: ENSMUST00000073350
AA Change: Y190H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073072
Gene: ENSMUSG00000004552
AA Change: Y190H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:A1_Propeptide 22 50 7e-14 PFAM
Pfam:Asp 78 395 2.1e-129 PFAM
Pfam:TAXi_N 79 236 1.3e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112411
AA Change: Y190H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108030
Gene: ENSMUSG00000004552
AA Change: Y190H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:A1_Propeptide 22 50 2.7e-12 PFAM
Pfam:Asp 78 315 2e-99 PFAM
Pfam:TAXi_N 79 236 6.1e-14 PFAM
Pfam:Asp 310 362 6.8e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartate proteases and preproprotein that is proteolytically processed to generate a mature protein product. The encoded protein may be involved in antigen processing and the maturation of secretory proteins. Elevated expression of this gene has been observed in neurodegeneration. Homozygous knockout mice for this gene exhibit lysosomal storage disorder, impaired autophagy, mitochondrial abnormalities, dermatitis, and reduced weight gain in an obesity model. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile, but develop skin lesions on the face, ears, neck and dorsal skin which are similar to those seen in human atopic dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,503,044 T3044I probably damaging Het
Apbb1ip C T 2: 22,874,992 P562S unknown Het
Arhgap44 A G 11: 65,022,034 M477T possibly damaging Het
Arhgef12 T C 9: 42,971,058 T1497A probably benign Het
Atp5h T C 11: 115,416,872 D91G probably damaging Het
Atp6v0a4 A G 6: 38,074,229 F405L probably damaging Het
Bicc1 T A 10: 70,932,108 T893S probably damaging Het
Cacna1i T A 15: 80,373,634 C1122S probably damaging Het
Capn7 A G 14: 31,358,679 E369G probably damaging Het
Cass4 T A 2: 172,427,669 L557Q probably damaging Het
Cdh5 A G 8: 104,113,040 I48V probably benign Het
Crisp3 T C 17: 40,235,922 K35R probably benign Het
Csde1 G A 3: 103,038,755 A22T possibly damaging Het
Cyp2d34 T A 15: 82,620,787 D24V possibly damaging Het
D630045J12Rik A T 6: 38,190,723 Y981* probably null Het
Dclre1a G A 19: 56,544,950 T404I possibly damaging Het
Dmc1 T C 15: 79,601,545 D23G probably damaging Het
Dnah8 C T 17: 30,840,713 T4429M probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fn3k A T 11: 121,439,311 M107L probably benign Het
Fxyd5 A G 7: 31,041,429 L10P probably damaging Het
Gm4922 C T 10: 18,784,012 D321N probably benign Het
Gm7714 T C 5: 88,282,524 V93A possibly damaging Het
Gm884 T C 11: 103,543,315 I3009M unknown Het
Gtf2h3 A G 5: 124,595,987 *310W probably null Het
Hapln2 G A 3: 88,023,544 T180I possibly damaging Het
Herc1 T G 9: 66,487,950 V4189G probably damaging Het
Iqgap1 A G 7: 80,730,127 V1166A probably damaging Het
Kcnk10 T C 12: 98,435,099 N439S Het
Klhl3 A T 13: 58,113,154 M15K Het
Klk1b26 A T 7: 44,016,120 T151S probably benign Het
Krtap5-1 C A 7: 142,296,462 C176F unknown Het
Krtap5-3 T A 7: 142,201,956 C177S unknown Het
Map1a T C 2: 121,299,020 F180L probably damaging Het
Mfap5 T C 6: 122,521,930 probably null Het
Nckap1 T A 2: 80,524,664 H638L possibly damaging Het
Olfr506 T A 7: 108,612,943 I212N probably benign Het
Olfr910 T G 9: 38,539,348 M151R noncoding transcript Het
Optc C T 1: 133,905,072 V97M probably benign Het
Piezo1 A G 8: 122,501,559 Y330H Het
Ppp1r12b G T 1: 134,876,148 N424K probably benign Het
Prdm5 T A 6: 65,936,074 F580L probably damaging Het
Prr27 A C 5: 87,846,312 K348N possibly damaging Het
Prr30 A G 14: 101,198,386 Y247H possibly damaging Het
Sec24d T C 3: 123,305,886 V336A possibly damaging Het
Serac1 A T 17: 6,050,758 L457H probably damaging Het
Serpina1f A G 12: 103,693,498 I175T probably damaging Het
Sspo A T 6: 48,449,963 H242L probably benign Het
Tcaf2 A T 6: 42,630,024 M332K probably benign Het
Tnrc6a T A 7: 123,170,071 N361K possibly damaging Het
Trim43b G T 9: 89,085,405 H393N possibly damaging Het
Ush2a T C 1: 188,444,641 L1334S probably benign Het
Usp35 T C 7: 97,312,344 E625G probably benign Het
Other mutations in Ctse
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02151:Ctse APN 1 131672535 missense probably benign 0.00
IGL02492:Ctse APN 1 131668234 missense probably damaging 1.00
R0057:Ctse UTSW 1 131663371 missense probably damaging 1.00
R0057:Ctse UTSW 1 131663371 missense probably damaging 1.00
R0690:Ctse UTSW 1 131674778 splice site probably benign
R2198:Ctse UTSW 1 131672447 nonsense probably null
R4190:Ctse UTSW 1 131662741 missense probably benign 0.02
R4668:Ctse UTSW 1 131662749 missense probably damaging 1.00
R4971:Ctse UTSW 1 131664392 missense probably damaging 1.00
R5070:Ctse UTSW 1 131668179 missense probably damaging 1.00
R5499:Ctse UTSW 1 131672513 nonsense probably null
R5705:Ctse UTSW 1 131664374 missense possibly damaging 0.82
R7207:Ctse UTSW 1 131664374 missense possibly damaging 0.82
R7828:Ctse UTSW 1 131662753 missense probably damaging 1.00
R8157:Ctse UTSW 1 131672511 missense probably damaging 1.00
R8237:Ctse UTSW 1 131662729 missense probably benign 0.01
X0067:Ctse UTSW 1 131670772 missense probably damaging 1.00
Z1177:Ctse UTSW 1 131672444 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGTGAAAATCTGTGTGCCTATTTCC -3'
(R):5'- TTCATGGGCCTCAGAACCTTG -3'

Sequencing Primer
(F):5'- TATTTCCCCAGGAGGCTGAG -3'
(R):5'- GAAGTCTTATGTACCAGGCCATCTG -3'
Posted On2020-07-28