Incidental Mutation 'R8270:Optc'
ID639422
Institutional Source Beutler Lab
Gene Symbol Optc
Ensembl Gene ENSMUSG00000010311
Gene Nameopticin
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8270 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location133897199-133907999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 133905072 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 97 (V97M)
Ref Sequence ENSEMBL: ENSMUSP00000120568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124051] [ENSMUST00000149380] [ENSMUST00000153617]
Predicted Effect probably benign
Transcript: ENSMUST00000124051
AA Change: V97M

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000120568
Gene: ENSMUSG00000010311
AA Change: V97M

DomainStartEndE-ValueType
low complexity region 42 70 N/A INTRINSIC
low complexity region 78 88 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
LRRNT 176 206 2.22e-2 SMART
LRR 200 224 3.55e1 SMART
LRR_TYP 225 248 6.78e-3 SMART
LRR 249 271 4.21e1 SMART
LRR 295 318 1.76e1 SMART
LRR 319 339 3.36e1 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000117086
Gene: ENSMUSG00000010311
AA Change: V86M

DomainStartEndE-ValueType
low complexity region 32 60 N/A INTRINSIC
low complexity region 68 78 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
LRRNT 166 196 2.22e-2 SMART
LRR 190 214 3.55e1 SMART
LRR_TYP 215 238 6.78e-3 SMART
LRR 239 261 4.21e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149380
AA Change: V97M

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000115661
Gene: ENSMUSG00000010311
AA Change: V97M

DomainStartEndE-ValueType
low complexity region 42 70 N/A INTRINSIC
low complexity region 78 88 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
LRR 173 195 1.22e1 SMART
LRR 196 218 4.21e1 SMART
LRR 242 265 1.76e1 SMART
LRR 266 286 3.36e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153617
AA Change: V97M

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000123262
Gene: ENSMUSG00000010311
AA Change: V97M

DomainStartEndE-ValueType
low complexity region 42 70 N/A INTRINSIC
low complexity region 78 88 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
LRR 173 195 1.22e1 SMART
LRR 196 218 4.21e1 SMART
LRR 242 265 1.76e1 SMART
LRR 266 286 3.36e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Opticin belongs to class III of the small leucine-rich repeat protein (SLRP) family. Members of this family are typically associated with the extracellular matrix. Opticin is present in significant quantities in the vitreous of the eye and also localizes to the cornea, iris, ciliary body, optic nerve, choroid, retina, and fetal liver. Opticin may noncovalently bind collagen fibrils and regulate fibril morphology, spacing, and organization. The opticin gene is mapped to a region of chromosome 1 that is associated with the inherited eye diseases age-related macular degeneration (AMD) and posterior column ataxia with retinosa pigmentosa (AXPC1). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased preretinal neovascularization in an oxygen-induced retinopathy model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,503,044 T3044I probably damaging Het
Apbb1ip C T 2: 22,874,992 P562S unknown Het
Arhgap44 A G 11: 65,022,034 M477T possibly damaging Het
Arhgef12 T C 9: 42,971,058 T1497A probably benign Het
Atp5h T C 11: 115,416,872 D91G probably damaging Het
Atp6v0a4 A G 6: 38,074,229 F405L probably damaging Het
Bicc1 T A 10: 70,932,108 T893S probably damaging Het
Cacna1i T A 15: 80,373,634 C1122S probably damaging Het
Capn7 A G 14: 31,358,679 E369G probably damaging Het
Cass4 T A 2: 172,427,669 L557Q probably damaging Het
Cdh5 A G 8: 104,113,040 I48V probably benign Het
Crisp3 T C 17: 40,235,922 K35R probably benign Het
Csde1 G A 3: 103,038,755 A22T possibly damaging Het
Ctse T C 1: 131,668,139 Y190H probably damaging Het
Cyp2d34 T A 15: 82,620,787 D24V possibly damaging Het
D630045J12Rik A T 6: 38,190,723 Y981* probably null Het
Dclre1a G A 19: 56,544,950 T404I possibly damaging Het
Dmc1 T C 15: 79,601,545 D23G probably damaging Het
Dnah8 C T 17: 30,840,713 T4429M probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fn3k A T 11: 121,439,311 M107L probably benign Het
Fxyd5 A G 7: 31,041,429 L10P probably damaging Het
Gm4922 C T 10: 18,784,012 D321N probably benign Het
Gm7714 T C 5: 88,282,524 V93A possibly damaging Het
Gm884 T C 11: 103,543,315 I3009M unknown Het
Gtf2h3 A G 5: 124,595,987 *310W probably null Het
Hapln2 G A 3: 88,023,544 T180I possibly damaging Het
Herc1 T G 9: 66,487,950 V4189G probably damaging Het
Iqgap1 A G 7: 80,730,127 V1166A probably damaging Het
Kcnk10 T C 12: 98,435,099 N439S Het
Klhl3 A T 13: 58,113,154 M15K Het
Klk1b26 A T 7: 44,016,120 T151S probably benign Het
Krtap5-1 C A 7: 142,296,462 C176F unknown Het
Krtap5-3 T A 7: 142,201,956 C177S unknown Het
Map1a T C 2: 121,299,020 F180L probably damaging Het
Mfap5 T C 6: 122,521,930 probably null Het
Nckap1 T A 2: 80,524,664 H638L possibly damaging Het
Olfr506 T A 7: 108,612,943 I212N probably benign Het
Olfr910 T G 9: 38,539,348 M151R noncoding transcript Het
Piezo1 A G 8: 122,501,559 Y330H Het
Ppp1r12b G T 1: 134,876,148 N424K probably benign Het
Prdm5 T A 6: 65,936,074 F580L probably damaging Het
Prr27 A C 5: 87,846,312 K348N possibly damaging Het
Prr30 A G 14: 101,198,386 Y247H possibly damaging Het
Sec24d T C 3: 123,305,886 V336A possibly damaging Het
Serac1 A T 17: 6,050,758 L457H probably damaging Het
Serpina1f A G 12: 103,693,498 I175T probably damaging Het
Sspo A T 6: 48,449,963 H242L probably benign Het
Tcaf2 A T 6: 42,630,024 M332K probably benign Het
Tnrc6a T A 7: 123,170,071 N361K possibly damaging Het
Trim43b G T 9: 89,085,405 H393N possibly damaging Het
Ush2a T C 1: 188,444,641 L1334S probably benign Het
Usp35 T C 7: 97,312,344 E625G probably benign Het
Other mutations in Optc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Optc APN 1 133902108 missense probably damaging 1.00
IGL01900:Optc APN 1 133902129 missense possibly damaging 0.68
IGL01988:Optc APN 1 133906929 critical splice donor site probably null
IGL02070:Optc APN 1 133901176 missense probably damaging 1.00
IGL02859:Optc APN 1 133902061 missense probably damaging 1.00
IGL03166:Optc APN 1 133903792 splice site probably benign
R0826:Optc UTSW 1 133905155 missense probably benign 0.07
R1728:Optc UTSW 1 133903796 splice site probably null
R1728:Optc UTSW 1 133905170 missense probably benign
R1729:Optc UTSW 1 133903796 splice site probably null
R1729:Optc UTSW 1 133905170 missense probably benign
R1730:Optc UTSW 1 133903796 splice site probably null
R1730:Optc UTSW 1 133905170 missense probably benign
R1739:Optc UTSW 1 133903796 splice site probably null
R1739:Optc UTSW 1 133905170 missense probably benign
R1762:Optc UTSW 1 133903796 splice site probably null
R1762:Optc UTSW 1 133905170 missense probably benign
R1783:Optc UTSW 1 133903796 splice site probably null
R1783:Optc UTSW 1 133905170 missense probably benign
R1784:Optc UTSW 1 133903796 splice site probably null
R1784:Optc UTSW 1 133905170 missense probably benign
R1785:Optc UTSW 1 133903796 splice site probably null
R1785:Optc UTSW 1 133905170 missense probably benign
R2049:Optc UTSW 1 133903796 splice site probably null
R2130:Optc UTSW 1 133903796 splice site probably null
R2131:Optc UTSW 1 133903796 splice site probably null
R2133:Optc UTSW 1 133903796 splice site probably null
R2141:Optc UTSW 1 133903796 splice site probably null
R2142:Optc UTSW 1 133903796 splice site probably null
R3436:Optc UTSW 1 133897879 missense probably damaging 1.00
R3437:Optc UTSW 1 133897879 missense probably damaging 1.00
R3711:Optc UTSW 1 133905081 missense probably benign 0.15
R3902:Optc UTSW 1 133897963 missense probably benign 0.10
R3930:Optc UTSW 1 133901182 nonsense probably null
R4078:Optc UTSW 1 133898349 missense probably damaging 1.00
R4523:Optc UTSW 1 133903754 missense possibly damaging 0.94
R4672:Optc UTSW 1 133897817 missense possibly damaging 0.48
R5113:Optc UTSW 1 133900977 splice site probably benign
R5176:Optc UTSW 1 133902084 missense probably benign 0.00
R5530:Optc UTSW 1 133905090 missense probably benign 0.01
R5692:Optc UTSW 1 133900976 splice site probably benign
R5819:Optc UTSW 1 133897879 missense probably damaging 1.00
R6208:Optc UTSW 1 133904999 missense probably damaging 1.00
R6828:Optc UTSW 1 133897867 missense probably damaging 1.00
R6859:Optc UTSW 1 133897816 missense possibly damaging 0.95
R6986:Optc UTSW 1 133897964 missense probably benign 0.00
R7349:Optc UTSW 1 133897879 missense probably damaging 1.00
R7754:Optc UTSW 1 133906992 missense possibly damaging 0.73
X0025:Optc UTSW 1 133897911 missense probably damaging 1.00
Z1177:Optc UTSW 1 133901085 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TTTGTATTATAGGGCAGGTGAAAAG -3'
(R):5'- AGGCTGCCTAACTTGGTGAG -3'

Sequencing Primer
(F):5'- CAGGTGAAAAGGGATCTGGTC -3'
(R):5'- GTACCTCAGAGGGATTCAGCCATTC -3'
Posted On2020-07-28