Incidental Mutation 'R8270:Csde1'
ID639430
Institutional Source Beutler Lab
Gene Symbol Csde1
Ensembl Gene ENSMUSG00000068823
Gene Namecold shock domain containing E1, RNA binding
Synonymsunr, D3Jfr1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R8270 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location103020426-103058186 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 103038755 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 22 (A22T)
Ref Sequence ENSEMBL: ENSMUSP00000029446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029446] [ENSMUST00000195889] [ENSMUST00000197488] [ENSMUST00000197827] [ENSMUST00000198180] [ENSMUST00000199240] [ENSMUST00000199420] [ENSMUST00000199571]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029446
AA Change: A22T

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029446
Gene: ENSMUSG00000068823
AA Change: A22T

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 187 248 1.52e-19 SMART
CSP 350 413 6.22e-16 SMART
CSP 520 582 2.86e-15 SMART
CSP 675 738 2.2e-16 SMART
Pfam:SUZ-C 757 788 3.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195889
SMART Domains Protein: ENSMUSP00000142647
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 58 119 9e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000197488
AA Change: A22T

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143524
Gene: ENSMUSG00000068823
AA Change: A22T

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 726 757 1.7e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000197827
AA Change: A22T

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143503
Gene: ENSMUSG00000068823
AA Change: A22T

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 187 248 1.52e-19 SMART
CSP 350 413 6.22e-16 SMART
CSP 520 582 2.86e-15 SMART
CSP 675 738 2.2e-16 SMART
Pfam:SUZ-C 757 788 3.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198174
Predicted Effect possibly damaging
Transcript: ENSMUST00000198180
AA Change: A22T

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142983
Gene: ENSMUSG00000068823
AA Change: A22T

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 725 758 5.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199240
SMART Domains Protein: ENSMUSP00000143050
Gene: ENSMUSG00000068823

DomainStartEndE-ValueType
CSP 57 118 9e-22 SMART
CSP 220 283 3.8e-18 SMART
CSP 390 452 1.7e-17 SMART
CSP 545 608 1.4e-18 SMART
Pfam:SUZ-C 626 659 6.2e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199420
AA Change: A22T

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142703
Gene: ENSMUSG00000068823
AA Change: A22T

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 725 758 5.4e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199571
AA Change: A22T

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143028
Gene: ENSMUSG00000068823
AA Change: A22T

DomainStartEndE-ValueType
CSP 27 90 3.11e-16 SMART
CSP 156 217 1.52e-19 SMART
CSP 319 382 6.22e-16 SMART
CSP 489 551 2.86e-15 SMART
CSP 644 707 2.2e-16 SMART
Pfam:SUZ-C 725 758 5.4e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,503,044 T3044I probably damaging Het
Apbb1ip C T 2: 22,874,992 P562S unknown Het
Arhgap44 A G 11: 65,022,034 M477T possibly damaging Het
Arhgef12 T C 9: 42,971,058 T1497A probably benign Het
Atp5h T C 11: 115,416,872 D91G probably damaging Het
Atp6v0a4 A G 6: 38,074,229 F405L probably damaging Het
Bicc1 T A 10: 70,932,108 T893S probably damaging Het
Cacna1i T A 15: 80,373,634 C1122S probably damaging Het
Capn7 A G 14: 31,358,679 E369G probably damaging Het
Cass4 T A 2: 172,427,669 L557Q probably damaging Het
Cdh5 A G 8: 104,113,040 I48V probably benign Het
Crisp3 T C 17: 40,235,922 K35R probably benign Het
Ctse T C 1: 131,668,139 Y190H probably damaging Het
Cyp2d34 T A 15: 82,620,787 D24V possibly damaging Het
D630045J12Rik A T 6: 38,190,723 Y981* probably null Het
Dclre1a G A 19: 56,544,950 T404I possibly damaging Het
Dmc1 T C 15: 79,601,545 D23G probably damaging Het
Dnah8 C T 17: 30,840,713 T4429M probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fn3k A T 11: 121,439,311 M107L probably benign Het
Fxyd5 A G 7: 31,041,429 L10P probably damaging Het
Gm4922 C T 10: 18,784,012 D321N probably benign Het
Gm7714 T C 5: 88,282,524 V93A possibly damaging Het
Gm884 T C 11: 103,543,315 I3009M unknown Het
Gtf2h3 A G 5: 124,595,987 *310W probably null Het
Hapln2 G A 3: 88,023,544 T180I possibly damaging Het
Herc1 T G 9: 66,487,950 V4189G probably damaging Het
Iqgap1 A G 7: 80,730,127 V1166A probably damaging Het
Kcnk10 T C 12: 98,435,099 N439S Het
Klhl3 A T 13: 58,113,154 M15K Het
Klk1b26 A T 7: 44,016,120 T151S probably benign Het
Krtap5-1 C A 7: 142,296,462 C176F unknown Het
Krtap5-3 T A 7: 142,201,956 C177S unknown Het
Map1a T C 2: 121,299,020 F180L probably damaging Het
Mfap5 T C 6: 122,521,930 probably null Het
Nckap1 T A 2: 80,524,664 H638L possibly damaging Het
Olfr506 T A 7: 108,612,943 I212N probably benign Het
Olfr910 T G 9: 38,539,348 M151R noncoding transcript Het
Optc C T 1: 133,905,072 V97M probably benign Het
Piezo1 A G 8: 122,501,559 Y330H Het
Ppp1r12b G T 1: 134,876,148 N424K probably benign Het
Prdm5 T A 6: 65,936,074 F580L probably damaging Het
Prr27 A C 5: 87,846,312 K348N possibly damaging Het
Prr30 A G 14: 101,198,386 Y247H possibly damaging Het
Sec24d T C 3: 123,305,886 V336A possibly damaging Het
Serac1 A T 17: 6,050,758 L457H probably damaging Het
Serpina1f A G 12: 103,693,498 I175T probably damaging Het
Sspo A T 6: 48,449,963 H242L probably benign Het
Tcaf2 A T 6: 42,630,024 M332K probably benign Het
Tnrc6a T A 7: 123,170,071 N361K possibly damaging Het
Trim43b G T 9: 89,085,405 H393N possibly damaging Het
Ush2a T C 1: 188,444,641 L1334S probably benign Het
Usp35 T C 7: 97,312,344 E625G probably benign Het
Other mutations in Csde1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Csde1 APN 3 103040525 missense possibly damaging 0.80
IGL01419:Csde1 APN 3 103038770 missense probably damaging 1.00
IGL02147:Csde1 APN 3 103039934 missense probably damaging 1.00
IGL02161:Csde1 APN 3 103050338 missense probably damaging 0.99
IGL02442:Csde1 APN 3 103054819 missense probably benign 0.20
IGL03036:Csde1 APN 3 103043839 missense probably damaging 0.99
R0526:Csde1 UTSW 3 103056426 missense possibly damaging 0.76
R0727:Csde1 UTSW 3 103043638 missense probably benign
R1738:Csde1 UTSW 3 103029177 intron probably benign
R1744:Csde1 UTSW 3 103050315 missense probably benign 0.31
R2007:Csde1 UTSW 3 103044791 missense probably damaging 1.00
R4665:Csde1 UTSW 3 103047072 missense probably damaging 1.00
R4806:Csde1 UTSW 3 103056369 unclassified probably benign
R5202:Csde1 UTSW 3 103039934 missense probably damaging 1.00
R5298:Csde1 UTSW 3 103047209 splice site probably null
R5429:Csde1 UTSW 3 103052841 missense possibly damaging 0.75
R5896:Csde1 UTSW 3 103040543 intron probably benign
R6076:Csde1 UTSW 3 103041229 missense possibly damaging 0.82
R6093:Csde1 UTSW 3 103052902 missense probably damaging 1.00
R6118:Csde1 UTSW 3 103054754 missense probably benign 0.45
R6213:Csde1 UTSW 3 103040514 missense probably damaging 1.00
R6263:Csde1 UTSW 3 103040017 missense probably benign 0.05
R6653:Csde1 UTSW 3 103052868 missense probably damaging 1.00
R6894:Csde1 UTSW 3 103044656 missense possibly damaging 0.56
R7155:Csde1 UTSW 3 103039953 missense probably damaging 0.99
R8253:Csde1 UTSW 3 103038721 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCCTAAGGACTTGAGTGTGTG -3'
(R):5'- GCAGACACACAGTAGAAAGTTC -3'

Sequencing Primer
(F):5'- CCTAAGGACTTGAGTGTGTGTTGTG -3'
(R):5'- GTTCAAAAGTGAGCTGACAGATTACC -3'
Posted On2020-07-28