Incidental Mutation 'R8270:Tcaf2'
ID639437
Institutional Source Beutler Lab
Gene Symbol Tcaf2
Ensembl Gene ENSMUSG00000029851
Gene NameTRPM8 channel-associated factor 2
SynonymsFam115c
Accession Numbers

Ncbi RefSeq: NM_146174.1; MGI:2385258

Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R8270 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location42623016-42645254 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42630024 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 332 (M332K)
Ref Sequence ENSEMBL: ENSMUSP00000031879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031879]
Predicted Effect probably benign
Transcript: ENSMUST00000031879
AA Change: M332K

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000031879
Gene: ENSMUSG00000029851
AA Change: M332K

DomainStartEndE-ValueType
low complexity region 515 526 N/A INTRINSIC
M60-like 543 842 4.85e-138 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,503,044 T3044I probably damaging Het
Apbb1ip C T 2: 22,874,992 P562S unknown Het
Arhgap44 A G 11: 65,022,034 M477T possibly damaging Het
Arhgef12 T C 9: 42,971,058 T1497A probably benign Het
Atp5h T C 11: 115,416,872 D91G probably damaging Het
Atp6v0a4 A G 6: 38,074,229 F405L probably damaging Het
Bicc1 T A 10: 70,932,108 T893S probably damaging Het
Cacna1i T A 15: 80,373,634 C1122S probably damaging Het
Capn7 A G 14: 31,358,679 E369G probably damaging Het
Cass4 T A 2: 172,427,669 L557Q probably damaging Het
Cdh5 A G 8: 104,113,040 I48V probably benign Het
Crisp3 T C 17: 40,235,922 K35R probably benign Het
Csde1 G A 3: 103,038,755 A22T possibly damaging Het
Ctse T C 1: 131,668,139 Y190H probably damaging Het
Cyp2d34 T A 15: 82,620,787 D24V possibly damaging Het
D630045J12Rik A T 6: 38,190,723 Y981* probably null Het
Dclre1a G A 19: 56,544,950 T404I possibly damaging Het
Dmc1 T C 15: 79,601,545 D23G probably damaging Het
Dnah8 C T 17: 30,840,713 T4429M probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fn3k A T 11: 121,439,311 M107L probably benign Het
Fxyd5 A G 7: 31,041,429 L10P probably damaging Het
Gm4922 C T 10: 18,784,012 D321N probably benign Het
Gm7714 T C 5: 88,282,524 V93A possibly damaging Het
Gm884 T C 11: 103,543,315 I3009M unknown Het
Gtf2h3 A G 5: 124,595,987 *310W probably null Het
Hapln2 G A 3: 88,023,544 T180I possibly damaging Het
Herc1 T G 9: 66,487,950 V4189G probably damaging Het
Iqgap1 A G 7: 80,730,127 V1166A probably damaging Het
Kcnk10 T C 12: 98,435,099 N439S Het
Klhl3 A T 13: 58,113,154 M15K Het
Klk1b26 A T 7: 44,016,120 T151S probably benign Het
Krtap5-1 C A 7: 142,296,462 C176F unknown Het
Krtap5-3 T A 7: 142,201,956 C177S unknown Het
Map1a T C 2: 121,299,020 F180L probably damaging Het
Mfap5 T C 6: 122,521,930 probably null Het
Nckap1 T A 2: 80,524,664 H638L possibly damaging Het
Olfr506 T A 7: 108,612,943 I212N probably benign Het
Olfr910 T G 9: 38,539,348 M151R noncoding transcript Het
Optc C T 1: 133,905,072 V97M probably benign Het
Piezo1 A G 8: 122,501,559 Y330H Het
Ppp1r12b G T 1: 134,876,148 N424K probably benign Het
Prdm5 T A 6: 65,936,074 F580L probably damaging Het
Prr27 A C 5: 87,846,312 K348N possibly damaging Het
Prr30 A G 14: 101,198,386 Y247H possibly damaging Het
Sec24d T C 3: 123,305,886 V336A possibly damaging Het
Serac1 A T 17: 6,050,758 L457H probably damaging Het
Serpina1f A G 12: 103,693,498 I175T probably damaging Het
Sspo A T 6: 48,449,963 H242L probably benign Het
Tnrc6a T A 7: 123,170,071 N361K possibly damaging Het
Trim43b G T 9: 89,085,405 H393N possibly damaging Het
Ush2a T C 1: 188,444,641 L1334S probably benign Het
Usp35 T C 7: 97,312,344 E625G probably benign Het
Other mutations in Tcaf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Tcaf2 APN 6 42630036 nonsense probably null
IGL00909:Tcaf2 APN 6 42624576 missense probably damaging 1.00
IGL01448:Tcaf2 APN 6 42630328 missense probably benign 0.05
IGL01870:Tcaf2 APN 6 42624477 missense possibly damaging 0.47
IGL02133:Tcaf2 APN 6 42627396 missense probably benign 0.06
IGL02208:Tcaf2 APN 6 42629086 missense probably damaging 1.00
IGL02666:Tcaf2 APN 6 42629124 splice site probably benign
PIT4260001:Tcaf2 UTSW 6 42642805 missense probably damaging 0.97
PIT4382001:Tcaf2 UTSW 6 42624366 makesense probably null
R0029:Tcaf2 UTSW 6 42630159 nonsense probably null
R0029:Tcaf2 UTSW 6 42630159 nonsense probably null
R0047:Tcaf2 UTSW 6 42629613 missense probably benign
R0047:Tcaf2 UTSW 6 42629613 missense probably benign
R0255:Tcaf2 UTSW 6 42642904 missense possibly damaging 0.95
R0617:Tcaf2 UTSW 6 42642511 missense probably damaging 0.97
R1387:Tcaf2 UTSW 6 42624578 missense probably damaging 1.00
R1523:Tcaf2 UTSW 6 42624451 nonsense probably null
R1529:Tcaf2 UTSW 6 42629506 missense probably benign 0.03
R1698:Tcaf2 UTSW 6 42628017 nonsense probably null
R1992:Tcaf2 UTSW 6 42629857 missense probably benign
R2065:Tcaf2 UTSW 6 42628047 missense probably benign 0.12
R2144:Tcaf2 UTSW 6 42642804 missense probably benign 0.45
R2435:Tcaf2 UTSW 6 42630364 missense possibly damaging 0.72
R2519:Tcaf2 UTSW 6 42629431 missense possibly damaging 0.92
R3979:Tcaf2 UTSW 6 42642547 missense probably damaging 1.00
R4093:Tcaf2 UTSW 6 42642838 missense probably damaging 1.00
R4532:Tcaf2 UTSW 6 42626437 missense probably damaging 1.00
R4780:Tcaf2 UTSW 6 42628062 missense probably damaging 1.00
R4906:Tcaf2 UTSW 6 42629745 missense probably benign 0.02
R4993:Tcaf2 UTSW 6 42642640 missense probably damaging 1.00
R5076:Tcaf2 UTSW 6 42629467 missense probably benign 0.16
R5643:Tcaf2 UTSW 6 42642773 missense possibly damaging 0.85
R5644:Tcaf2 UTSW 6 42642773 missense possibly damaging 0.85
R5975:Tcaf2 UTSW 6 42642778 missense probably benign 0.22
R6234:Tcaf2 UTSW 6 42630374 missense probably benign
R6269:Tcaf2 UTSW 6 42627408 missense probably damaging 1.00
R6276:Tcaf2 UTSW 6 42629753 missense probably benign 0.04
R6375:Tcaf2 UTSW 6 42626178 missense probably damaging 0.99
R6523:Tcaf2 UTSW 6 42643019 missense probably benign 0.01
R6825:Tcaf2 UTSW 6 42629518 missense probably benign 0.05
R7039:Tcaf2 UTSW 6 42626140 missense probably damaging 1.00
R7099:Tcaf2 UTSW 6 42630341 missense probably benign 0.02
R7284:Tcaf2 UTSW 6 42629538 missense probably damaging 1.00
R7822:Tcaf2 UTSW 6 42629099 missense possibly damaging 0.95
R7964:Tcaf2 UTSW 6 42629706 missense probably benign
R8505:Tcaf2 UTSW 6 42629541 missense probably benign 0.18
Y4339:Tcaf2 UTSW 6 42629472 missense probably benign
Y4341:Tcaf2 UTSW 6 42629472 missense probably benign
Z1177:Tcaf2 UTSW 6 42629616 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGAGGCCAAAAGTATTGAG -3'
(R):5'- TGGGGCTCGATAACTCCTTC -3'

Sequencing Primer
(F):5'- TATTGAGGATGACATTCCCAGG -3'
(R):5'- GGGGCTCGATAACTCCTTCCTTAG -3'
Posted On2020-07-28