Incidental Mutation 'R8270:Prdm5'
ID639439
Institutional Source Beutler Lab
Gene Symbol Prdm5
Ensembl Gene ENSMUSG00000029913
Gene NamePR domain containing 5
SynonymsPFM2, 4432417F03Rik, 6530401I24Rik, E130112L17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8270 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location65778988-65937010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65936074 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 580 (F580L)
Ref Sequence ENSEMBL: ENSMUSP00000031976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031973] [ENSMUST00000031976] [ENSMUST00000081219] [ENSMUST00000172638]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031973
AA Change: F396L

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031973
Gene: ENSMUSG00000029913
AA Change: F396L

DomainStartEndE-ValueType
PDB:3EP0|B 4 101 1e-11 PDB
Blast:SET 8 100 4e-64 BLAST
ZnF_C2H2 105 127 3.16e-3 SMART
ZnF_C2H2 133 155 8.81e-2 SMART
ZnF_C2H2 161 183 1.95e-3 SMART
ZnF_C2H2 189 211 6.78e-3 SMART
ZnF_C2H2 217 240 1.2e-3 SMART
ZnF_C2H2 246 268 4.87e-4 SMART
ZnF_C2H2 274 296 2.4e-3 SMART
ZnF_C2H2 302 324 2.43e-4 SMART
ZnF_C2H2 330 352 3.21e-4 SMART
ZnF_C2H2 358 380 1.45e-2 SMART
ZnF_C2H2 387 410 1.43e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000031976
AA Change: F580L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031976
Gene: ENSMUSG00000029913
AA Change: F580L

DomainStartEndE-ValueType
SET 8 130 2.01e-4 SMART
ZnF_C2H2 167 190 3.39e-3 SMART
ZnF_C2H2 199 221 1.04e-3 SMART
ZnF_C2H2 231 256 1.26e-2 SMART
ZnF_C2H2 264 286 1.95e-3 SMART
ZnF_C2H2 289 311 3.16e-3 SMART
ZnF_C2H2 317 339 8.81e-2 SMART
ZnF_C2H2 345 367 1.95e-3 SMART
ZnF_C2H2 373 395 6.78e-3 SMART
ZnF_C2H2 401 424 1.2e-3 SMART
ZnF_C2H2 430 452 4.87e-4 SMART
ZnF_C2H2 458 480 2.4e-3 SMART
ZnF_C2H2 486 508 2.43e-4 SMART
ZnF_C2H2 514 536 3.21e-4 SMART
ZnF_C2H2 542 564 1.45e-2 SMART
ZnF_C2H2 571 594 1.43e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081219
AA Change: F202L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079979
Gene: ENSMUSG00000029913
AA Change: F202L

DomainStartEndE-ValueType
Blast:SET 8 72 2e-34 BLAST
ZnF_C2H2 80 102 2.4e-3 SMART
ZnF_C2H2 108 130 2.43e-4 SMART
ZnF_C2H2 136 158 3.21e-4 SMART
ZnF_C2H2 164 186 1.45e-2 SMART
ZnF_C2H2 193 216 1.43e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172638
SMART Domains Protein: ENSMUSP00000133423
Gene: ENSMUSG00000029913

DomainStartEndE-ValueType
SET 8 130 2.01e-4 SMART
ZnF_C2H2 167 190 3.39e-3 SMART
ZnF_C2H2 199 221 1.04e-3 SMART
ZnF_C2H2 231 256 1.26e-2 SMART
ZnF_C2H2 264 286 1.95e-3 SMART
ZnF_C2H2 289 311 3.16e-3 SMART
ZnF_C2H2 317 339 8.81e-2 SMART
ZnF_C2H2 345 367 1.95e-3 SMART
ZnF_C2H2 373 395 6.78e-3 SMART
ZnF_C2H2 401 424 1.2e-3 SMART
ZnF_C2H2 430 452 4.87e-4 SMART
ZnF_C2H2 458 480 2.4e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor of the PR-domain protein family. It contains a PR-domain and multiple zinc finger motifs. Transcription factors of the PR-domain family are known to be involved in cell differentiation and tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a hypomorphic allele display delayed bone ossification with reduced collagen fibril formation, total bone area, bone mineral content and bone mineral density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,503,044 T3044I probably damaging Het
Apbb1ip C T 2: 22,874,992 P562S unknown Het
Arhgap44 A G 11: 65,022,034 M477T possibly damaging Het
Arhgef12 T C 9: 42,971,058 T1497A probably benign Het
Atp5h T C 11: 115,416,872 D91G probably damaging Het
Atp6v0a4 A G 6: 38,074,229 F405L probably damaging Het
Bicc1 T A 10: 70,932,108 T893S probably damaging Het
Cacna1i T A 15: 80,373,634 C1122S probably damaging Het
Capn7 A G 14: 31,358,679 E369G probably damaging Het
Cass4 T A 2: 172,427,669 L557Q probably damaging Het
Cdh5 A G 8: 104,113,040 I48V probably benign Het
Crisp3 T C 17: 40,235,922 K35R probably benign Het
Csde1 G A 3: 103,038,755 A22T possibly damaging Het
Ctse T C 1: 131,668,139 Y190H probably damaging Het
Cyp2d34 T A 15: 82,620,787 D24V possibly damaging Het
D630045J12Rik A T 6: 38,190,723 Y981* probably null Het
Dclre1a G A 19: 56,544,950 T404I possibly damaging Het
Dmc1 T C 15: 79,601,545 D23G probably damaging Het
Dnah8 C T 17: 30,840,713 T4429M probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fn3k A T 11: 121,439,311 M107L probably benign Het
Fxyd5 A G 7: 31,041,429 L10P probably damaging Het
Gm4922 C T 10: 18,784,012 D321N probably benign Het
Gm7714 T C 5: 88,282,524 V93A possibly damaging Het
Gm884 T C 11: 103,543,315 I3009M unknown Het
Gtf2h3 A G 5: 124,595,987 *310W probably null Het
Hapln2 G A 3: 88,023,544 T180I possibly damaging Het
Herc1 T G 9: 66,487,950 V4189G probably damaging Het
Iqgap1 A G 7: 80,730,127 V1166A probably damaging Het
Kcnk10 T C 12: 98,435,099 N439S Het
Klhl3 A T 13: 58,113,154 M15K Het
Klk1b26 A T 7: 44,016,120 T151S probably benign Het
Krtap5-1 C A 7: 142,296,462 C176F unknown Het
Krtap5-3 T A 7: 142,201,956 C177S unknown Het
Map1a T C 2: 121,299,020 F180L probably damaging Het
Mfap5 T C 6: 122,521,930 probably null Het
Nckap1 T A 2: 80,524,664 H638L possibly damaging Het
Olfr506 T A 7: 108,612,943 I212N probably benign Het
Olfr910 T G 9: 38,539,348 M151R noncoding transcript Het
Optc C T 1: 133,905,072 V97M probably benign Het
Piezo1 A G 8: 122,501,559 Y330H Het
Ppp1r12b G T 1: 134,876,148 N424K probably benign Het
Prr27 A C 5: 87,846,312 K348N possibly damaging Het
Prr30 A G 14: 101,198,386 Y247H possibly damaging Het
Sec24d T C 3: 123,305,886 V336A possibly damaging Het
Serac1 A T 17: 6,050,758 L457H probably damaging Het
Serpina1f A G 12: 103,693,498 I175T probably damaging Het
Sspo A T 6: 48,449,963 H242L probably benign Het
Tcaf2 A T 6: 42,630,024 M332K probably benign Het
Tnrc6a T A 7: 123,170,071 N361K possibly damaging Het
Trim43b G T 9: 89,085,405 H393N possibly damaging Het
Ush2a T C 1: 188,444,641 L1334S probably benign Het
Usp35 T C 7: 97,312,344 E625G probably benign Het
Other mutations in Prdm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Prdm5 APN 6 65870390 missense possibly damaging 0.93
IGL02363:Prdm5 APN 6 65794319 missense probably damaging 1.00
IGL02457:Prdm5 APN 6 65881116 missense probably damaging 1.00
IGL03190:Prdm5 APN 6 65856132 splice site probably benign
IGL03239:Prdm5 APN 6 65886078 splice site probably benign
IGL03377:Prdm5 APN 6 65859473 missense possibly damaging 0.93
R0329:Prdm5 UTSW 6 65862903 splice site probably benign
R0926:Prdm5 UTSW 6 65883547 missense probably damaging 0.99
R1458:Prdm5 UTSW 6 65883601 missense probably damaging 0.99
R1859:Prdm5 UTSW 6 65831279 missense probably benign 0.03
R1956:Prdm5 UTSW 6 65936076 missense probably damaging 1.00
R1996:Prdm5 UTSW 6 65936088 missense probably damaging 1.00
R1997:Prdm5 UTSW 6 65936088 missense probably damaging 1.00
R2019:Prdm5 UTSW 6 65831356 missense probably damaging 0.99
R3082:Prdm5 UTSW 6 65936085 missense probably damaging 1.00
R3819:Prdm5 UTSW 6 65936057 missense possibly damaging 0.92
R4411:Prdm5 UTSW 6 65901787 nonsense probably null
R4981:Prdm5 UTSW 6 65870462 missense probably damaging 0.99
R5077:Prdm5 UTSW 6 65779174 missense probably damaging 0.97
R5089:Prdm5 UTSW 6 65856090 missense probably benign 0.01
R5138:Prdm5 UTSW 6 65856102 nonsense probably null
R5735:Prdm5 UTSW 6 65927990 missense possibly damaging 0.93
R6355:Prdm5 UTSW 6 65883594 missense probably damaging 1.00
R6743:Prdm5 UTSW 6 65883651 missense probably damaging 1.00
R6769:Prdm5 UTSW 6 65862936 missense probably damaging 0.98
R7216:Prdm5 UTSW 6 65927983 nonsense probably null
R7305:Prdm5 UTSW 6 65831260 missense possibly damaging 0.83
R7510:Prdm5 UTSW 6 65927992 missense probably damaging 0.97
X0017:Prdm5 UTSW 6 65869262 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGAGAGCAGTATTTGTTCTTAGACC -3'
(R):5'- CTGTCAGATCAATGAATCCTTTGTG -3'

Sequencing Primer
(F):5'- GCAGTATTTGTTCTTAGACCCACTAG -3'
(R):5'- GGCTATTTCTGTTAAGCCGATCAG -3'
Posted On2020-07-28