Incidental Mutation 'R8270:Iqgap1'
ID639443
Institutional Source Beutler Lab
Gene Symbol Iqgap1
Ensembl Gene ENSMUSG00000030536
Gene NameIQ motif containing GTPase activating protein 1
SynonymsD7Ertd237e, D7Ertd257e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8270 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location80711583-80825974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80730127 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1166 (V1166A)
Ref Sequence ENSEMBL: ENSMUSP00000128278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167377]
Predicted Effect probably damaging
Transcript: ENSMUST00000167377
AA Change: V1166A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128278
Gene: ENSMUSG00000030536
AA Change: V1166A

DomainStartEndE-ValueType
CH 46 155 2.02e-20 SMART
internal_repeat_1 203 278 3.71e-8 PROSPERO
low complexity region 324 335 N/A INTRINSIC
low complexity region 390 399 N/A INTRINSIC
coiled coil region 488 515 N/A INTRINSIC
internal_repeat_1 608 684 3.71e-8 PROSPERO
IQ 744 766 3.85e-3 SMART
IQ 774 796 1.12e-4 SMART
IQ 804 826 1.32e-1 SMART
IQ 834 856 1.15e1 SMART
coiled coil region 886 914 N/A INTRINSIC
RasGAP 992 1345 7.46e-89 SMART
Pfam:RasGAP_C 1452 1580 4.5e-41 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains four IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. Expression of the protein is upregulated by gene amplification in two gastric cancer cell lines. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null allele exhibit a late-onset gastric hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,503,044 T3044I probably damaging Het
Apbb1ip C T 2: 22,874,992 P562S unknown Het
Arhgap44 A G 11: 65,022,034 M477T possibly damaging Het
Arhgef12 T C 9: 42,971,058 T1497A probably benign Het
Atp5h T C 11: 115,416,872 D91G probably damaging Het
Atp6v0a4 A G 6: 38,074,229 F405L probably damaging Het
Bicc1 T A 10: 70,932,108 T893S probably damaging Het
Cacna1i T A 15: 80,373,634 C1122S probably damaging Het
Capn7 A G 14: 31,358,679 E369G probably damaging Het
Cass4 T A 2: 172,427,669 L557Q probably damaging Het
Cdh5 A G 8: 104,113,040 I48V probably benign Het
Crisp3 T C 17: 40,235,922 K35R probably benign Het
Csde1 G A 3: 103,038,755 A22T possibly damaging Het
Ctse T C 1: 131,668,139 Y190H probably damaging Het
Cyp2d34 T A 15: 82,620,787 D24V possibly damaging Het
D630045J12Rik A T 6: 38,190,723 Y981* probably null Het
Dclre1a G A 19: 56,544,950 T404I possibly damaging Het
Dmc1 T C 15: 79,601,545 D23G probably damaging Het
Dnah8 C T 17: 30,840,713 T4429M probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fn3k A T 11: 121,439,311 M107L probably benign Het
Fxyd5 A G 7: 31,041,429 L10P probably damaging Het
Gm4922 C T 10: 18,784,012 D321N probably benign Het
Gm7714 T C 5: 88,282,524 V93A possibly damaging Het
Gm884 T C 11: 103,543,315 I3009M unknown Het
Gtf2h3 A G 5: 124,595,987 *310W probably null Het
Hapln2 G A 3: 88,023,544 T180I possibly damaging Het
Herc1 T G 9: 66,487,950 V4189G probably damaging Het
Kcnk10 T C 12: 98,435,099 N439S Het
Klhl3 A T 13: 58,113,154 M15K Het
Klk1b26 A T 7: 44,016,120 T151S probably benign Het
Krtap5-1 C A 7: 142,296,462 C176F unknown Het
Krtap5-3 T A 7: 142,201,956 C177S unknown Het
Map1a T C 2: 121,299,020 F180L probably damaging Het
Mfap5 T C 6: 122,521,930 probably null Het
Nckap1 T A 2: 80,524,664 H638L possibly damaging Het
Olfr506 T A 7: 108,612,943 I212N probably benign Het
Olfr910 T G 9: 38,539,348 M151R noncoding transcript Het
Optc C T 1: 133,905,072 V97M probably benign Het
Piezo1 A G 8: 122,501,559 Y330H Het
Ppp1r12b G T 1: 134,876,148 N424K probably benign Het
Prdm5 T A 6: 65,936,074 F580L probably damaging Het
Prr27 A C 5: 87,846,312 K348N possibly damaging Het
Prr30 A G 14: 101,198,386 Y247H possibly damaging Het
Sec24d T C 3: 123,305,886 V336A possibly damaging Het
Serac1 A T 17: 6,050,758 L457H probably damaging Het
Serpina1f A G 12: 103,693,498 I175T probably damaging Het
Sspo A T 6: 48,449,963 H242L probably benign Het
Tcaf2 A T 6: 42,630,024 M332K probably benign Het
Tnrc6a T A 7: 123,170,071 N361K possibly damaging Het
Trim43b G T 9: 89,085,405 H393N possibly damaging Het
Ush2a T C 1: 188,444,641 L1334S probably benign Het
Usp35 T C 7: 97,312,344 E625G probably benign Het
Other mutations in Iqgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Iqgap1 APN 7 80759844 missense probably benign 0.00
IGL00984:Iqgap1 APN 7 80726798 missense probably damaging 1.00
IGL01570:Iqgap1 APN 7 80723061 missense possibly damaging 0.76
IGL01738:Iqgap1 APN 7 80723900 missense possibly damaging 0.80
IGL02141:Iqgap1 APN 7 80738121 missense probably damaging 1.00
IGL02336:Iqgap1 APN 7 80752293 missense probably benign 0.39
IGL02416:Iqgap1 APN 7 80726038 missense probably damaging 1.00
IGL02597:Iqgap1 APN 7 80723885 missense probably damaging 1.00
IGL02662:Iqgap1 APN 7 80743079 missense probably benign
IGL03157:Iqgap1 APN 7 80751888 missense probably benign 0.34
IGL03189:Iqgap1 APN 7 80713842 missense probably benign 0.12
IGL03216:Iqgap1 APN 7 80743088 missense probably benign 0.33
R0024:Iqgap1 UTSW 7 80751939 missense probably benign
R0126:Iqgap1 UTSW 7 80738322 missense probably benign 0.00
R0144:Iqgap1 UTSW 7 80751920 missense probably damaging 1.00
R0325:Iqgap1 UTSW 7 80751930 missense probably benign 0.01
R0376:Iqgap1 UTSW 7 80723879 missense probably benign 0.01
R0650:Iqgap1 UTSW 7 80736395 missense probably damaging 1.00
R0652:Iqgap1 UTSW 7 80736395 missense probably damaging 1.00
R0741:Iqgap1 UTSW 7 80720987 missense probably benign 0.03
R0751:Iqgap1 UTSW 7 80725573 unclassified probably benign
R1067:Iqgap1 UTSW 7 80723828 missense probably benign 0.01
R1389:Iqgap1 UTSW 7 80759756 critical splice donor site probably null
R1473:Iqgap1 UTSW 7 80734011 missense probably benign 0.00
R1613:Iqgap1 UTSW 7 80768457 missense probably damaging 1.00
R1842:Iqgap1 UTSW 7 80760883 missense probably damaging 1.00
R1909:Iqgap1 UTSW 7 80743828 missense probably benign
R2062:Iqgap1 UTSW 7 80723979 nonsense probably null
R2149:Iqgap1 UTSW 7 80762560 missense probably damaging 1.00
R2153:Iqgap1 UTSW 7 80751953 missense probably benign 0.00
R2153:Iqgap1 UTSW 7 80759903 missense possibly damaging 0.55
R3160:Iqgap1 UTSW 7 80752338 missense probably benign
R3162:Iqgap1 UTSW 7 80752338 missense probably benign
R3605:Iqgap1 UTSW 7 80723789 missense probably benign 0.02
R3709:Iqgap1 UTSW 7 80717087 missense possibly damaging 0.87
R3935:Iqgap1 UTSW 7 80743837 missense possibly damaging 0.54
R3979:Iqgap1 UTSW 7 80759934 missense probably damaging 0.98
R4545:Iqgap1 UTSW 7 80762567 critical splice acceptor site probably null
R4787:Iqgap1 UTSW 7 80735513 missense probably damaging 1.00
R4925:Iqgap1 UTSW 7 80765317 missense probably damaging 1.00
R4953:Iqgap1 UTSW 7 80723776 splice site probably null
R5037:Iqgap1 UTSW 7 80734100 missense probably damaging 1.00
R5158:Iqgap1 UTSW 7 80743068 missense probably benign 0.02
R5183:Iqgap1 UTSW 7 80723065 missense probably damaging 1.00
R5262:Iqgap1 UTSW 7 80726742 missense probably benign 0.00
R5271:Iqgap1 UTSW 7 80734148 missense probably damaging 1.00
R5289:Iqgap1 UTSW 7 80738724 missense possibly damaging 0.88
R5359:Iqgap1 UTSW 7 80766959 missense probably benign 0.00
R5423:Iqgap1 UTSW 7 80799862 missense probably damaging 1.00
R5843:Iqgap1 UTSW 7 80726080 missense probably benign 0.03
R5849:Iqgap1 UTSW 7 80803158 missense probably benign
R6164:Iqgap1 UTSW 7 80809106 missense unknown
R6315:Iqgap1 UTSW 7 80799890 missense possibly damaging 0.65
R6335:Iqgap1 UTSW 7 80728024 missense probably damaging 1.00
R6488:Iqgap1 UTSW 7 80730326 missense probably benign 0.00
R6723:Iqgap1 UTSW 7 80723822 missense probably benign 0.01
R6800:Iqgap1 UTSW 7 80728981 missense possibly damaging 0.56
R6815:Iqgap1 UTSW 7 80766884 critical splice donor site probably null
R7240:Iqgap1 UTSW 7 80759839 missense probably benign 0.22
R7386:Iqgap1 UTSW 7 80726042 missense probably damaging 1.00
R7387:Iqgap1 UTSW 7 80720990 missense probably benign 0.03
R7410:Iqgap1 UTSW 7 80723030 nonsense probably null
R7429:Iqgap1 UTSW 7 80751440 missense probably benign 0.00
R7452:Iqgap1 UTSW 7 80760829 missense possibly damaging 0.80
R7615:Iqgap1 UTSW 7 80730100 missense probably damaging 1.00
R7615:Iqgap1 UTSW 7 80751346 missense probably benign
R7726:Iqgap1 UTSW 7 80757456 missense probably benign 0.37
R7783:Iqgap1 UTSW 7 80809059 missense probably benign 0.01
R7785:Iqgap1 UTSW 7 80738169 missense probably damaging 1.00
R7862:Iqgap1 UTSW 7 80743888 missense probably benign 0.04
RF004:Iqgap1 UTSW 7 80720875 missense probably benign
RF063:Iqgap1 UTSW 7 80723751 frame shift probably null
X0064:Iqgap1 UTSW 7 80720931 nonsense probably null
X0067:Iqgap1 UTSW 7 80766903 missense probably benign
Z1176:Iqgap1 UTSW 7 80768309 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTTACAGCTGCTCGTGAGG -3'
(R):5'- AAGCCTTGTCTCATGAAGAAGTG -3'

Sequencing Primer
(F):5'- AGCTGCTCGTGAGGCTCAC -3'
(R):5'- CCTTGTCTCATGAAGAAGTGAAGAC -3'
Posted On2020-07-28