Incidental Mutation 'R8270:Olfr506'
ID639445
Institutional Source Beutler Lab
Gene Symbol Olfr506
Ensembl Gene ENSMUSG00000058244
Gene Nameolfactory receptor 506
SynonymsGA_x6K02T2PBJ9-10942040-10942984, MOR204-23
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R8270 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location108610787-108615340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108612943 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 212 (I212N)
Ref Sequence ENSEMBL: ENSMUSP00000076566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077343] [ENSMUST00000209296]
Predicted Effect probably benign
Transcript: ENSMUST00000077343
AA Change: I212N

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000076566
Gene: ENSMUSG00000058244
AA Change: I212N

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 1e-53 PFAM
Pfam:7tm_1 44 293 4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209296
AA Change: I212N

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,503,044 T3044I probably damaging Het
Apbb1ip C T 2: 22,874,992 P562S unknown Het
Arhgap44 A G 11: 65,022,034 M477T possibly damaging Het
Arhgef12 T C 9: 42,971,058 T1497A probably benign Het
Atp5h T C 11: 115,416,872 D91G probably damaging Het
Atp6v0a4 A G 6: 38,074,229 F405L probably damaging Het
Bicc1 T A 10: 70,932,108 T893S probably damaging Het
Cacna1i T A 15: 80,373,634 C1122S probably damaging Het
Capn7 A G 14: 31,358,679 E369G probably damaging Het
Cass4 T A 2: 172,427,669 L557Q probably damaging Het
Cdh5 A G 8: 104,113,040 I48V probably benign Het
Crisp3 T C 17: 40,235,922 K35R probably benign Het
Csde1 G A 3: 103,038,755 A22T possibly damaging Het
Ctse T C 1: 131,668,139 Y190H probably damaging Het
Cyp2d34 T A 15: 82,620,787 D24V possibly damaging Het
D630045J12Rik A T 6: 38,190,723 Y981* probably null Het
Dclre1a G A 19: 56,544,950 T404I possibly damaging Het
Dmc1 T C 15: 79,601,545 D23G probably damaging Het
Dnah8 C T 17: 30,840,713 T4429M probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fn3k A T 11: 121,439,311 M107L probably benign Het
Fxyd5 A G 7: 31,041,429 L10P probably damaging Het
Gm4922 C T 10: 18,784,012 D321N probably benign Het
Gm7714 T C 5: 88,282,524 V93A possibly damaging Het
Gm884 T C 11: 103,543,315 I3009M unknown Het
Gtf2h3 A G 5: 124,595,987 *310W probably null Het
Hapln2 G A 3: 88,023,544 T180I possibly damaging Het
Herc1 T G 9: 66,487,950 V4189G probably damaging Het
Iqgap1 A G 7: 80,730,127 V1166A probably damaging Het
Kcnk10 T C 12: 98,435,099 N439S Het
Klhl3 A T 13: 58,113,154 M15K Het
Klk1b26 A T 7: 44,016,120 T151S probably benign Het
Krtap5-1 C A 7: 142,296,462 C176F unknown Het
Krtap5-3 T A 7: 142,201,956 C177S unknown Het
Map1a T C 2: 121,299,020 F180L probably damaging Het
Mfap5 T C 6: 122,521,930 probably null Het
Nckap1 T A 2: 80,524,664 H638L possibly damaging Het
Olfr910 T G 9: 38,539,348 M151R noncoding transcript Het
Optc C T 1: 133,905,072 V97M probably benign Het
Piezo1 A G 8: 122,501,559 Y330H Het
Ppp1r12b G T 1: 134,876,148 N424K probably benign Het
Prdm5 T A 6: 65,936,074 F580L probably damaging Het
Prr27 A C 5: 87,846,312 K348N possibly damaging Het
Prr30 A G 14: 101,198,386 Y247H possibly damaging Het
Sec24d T C 3: 123,305,886 V336A possibly damaging Het
Serac1 A T 17: 6,050,758 L457H probably damaging Het
Serpina1f A G 12: 103,693,498 I175T probably damaging Het
Sspo A T 6: 48,449,963 H242L probably benign Het
Tcaf2 A T 6: 42,630,024 M332K probably benign Het
Tnrc6a T A 7: 123,170,071 N361K possibly damaging Het
Trim43b G T 9: 89,085,405 H393N possibly damaging Het
Ush2a T C 1: 188,444,641 L1334S probably benign Het
Usp35 T C 7: 97,312,344 E625G probably benign Het
Other mutations in Olfr506
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01825:Olfr506 APN 7 108613054 missense probably damaging 0.97
IGL02480:Olfr506 APN 7 108612811 missense probably benign
IGL02802:Olfr506 UTSW 7 108612462 missense probably damaging 0.99
R0294:Olfr506 UTSW 7 108613150 missense probably damaging 1.00
R0398:Olfr506 UTSW 7 108612955 missense probably benign 0.30
R0452:Olfr506 UTSW 7 108612370 missense possibly damaging 0.62
R3788:Olfr506 UTSW 7 108613073 nonsense probably null
R7065:Olfr506 UTSW 7 108613059 missense probably damaging 0.99
R7345:Olfr506 UTSW 7 108613063 missense probably benign 0.11
R7671:Olfr506 UTSW 7 108612991 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGTCTGTATCCAGTTGCTTG -3'
(R):5'- ACCACCTTGTTCTGGTCTGTAG -3'

Sequencing Primer
(F):5'- GCTTGTAGTAGCATACATAAGTGG -3'
(R):5'- GAGTAATTTGACTTGGGCATCAC -3'
Posted On2020-07-28