Incidental Mutation 'R8270:Tnrc6a'
ID639446
Institutional Source Beutler Lab
Gene Symbol Tnrc6a
Ensembl Gene ENSMUSG00000052707
Gene Nametrinucleotide repeat containing 6a
SynonymsCAGH26, 2010321I05Rik, Tnrc6, 3110054G10Rik, D130023A07Rik
Accession Numbers

Genbank: NM_144925; MGI: 2385292

Is this an essential gene? Probably essential (E-score: 0.861) question?
Stock #R8270 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location123123885-123195296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123170071 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 361 (N361K)
Ref Sequence ENSEMBL: ENSMUSP00000091595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094053] [ENSMUST00000205514] [ENSMUST00000206014] [ENSMUST00000206888]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094053
AA Change: N361K

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091595
Gene: ENSMUSG00000052707
AA Change: N361K

DomainStartEndE-ValueType
coiled coil region 5 54 N/A INTRINSIC
low complexity region 69 92 N/A INTRINSIC
low complexity region 93 113 N/A INTRINSIC
low complexity region 281 294 N/A INTRINSIC
low complexity region 430 443 N/A INTRINSIC
low complexity region 568 590 N/A INTRINSIC
internal_repeat_1 690 853 3.51e-6 PROSPERO
low complexity region 858 871 N/A INTRINSIC
Pfam:Ago_hook 1028 1190 1.2e-29 PFAM
low complexity region 1284 1296 N/A INTRINSIC
low complexity region 1301 1316 N/A INTRINSIC
low complexity region 1337 1376 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1439 1714 1.5e-126 PFAM
RRM 1717 1784 4.95e-2 SMART
low complexity region 1808 1820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205514
Predicted Effect probably benign
Transcript: ENSMUST00000205760
Predicted Effect probably benign
Transcript: ENSMUST00000206014
Predicted Effect probably benign
Transcript: ENSMUST00000206888
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the trinucleotide repeat containing 6 protein family. The protein is highly similar to a human protein that functions in post-transcriptional gene silencing through the RNA interference (RNAi) and microRNA pathways. The human protein associates with messenger RNAs and argonaute proteins in cytoplasmic bodies known as GW-bodies or P-bodies, and inhibiting its expression delocalizes other GW-body proteins and impairs RNAi and microRNA-induced gene silencing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial embryonic lethality during organogenesis associated with impaired hematopoiesis. [provided by MGI curators]
Allele List at MGI

All alleles(21) : Gene trapped(21)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,503,044 T3044I probably damaging Het
Apbb1ip C T 2: 22,874,992 P562S unknown Het
Arhgap44 A G 11: 65,022,034 M477T possibly damaging Het
Arhgef12 T C 9: 42,971,058 T1497A probably benign Het
Atp5h T C 11: 115,416,872 D91G probably damaging Het
Atp6v0a4 A G 6: 38,074,229 F405L probably damaging Het
Bicc1 T A 10: 70,932,108 T893S probably damaging Het
Cacna1i T A 15: 80,373,634 C1122S probably damaging Het
Capn7 A G 14: 31,358,679 E369G probably damaging Het
Cass4 T A 2: 172,427,669 L557Q probably damaging Het
Cdh5 A G 8: 104,113,040 I48V probably benign Het
Crisp3 T C 17: 40,235,922 K35R probably benign Het
Csde1 G A 3: 103,038,755 A22T possibly damaging Het
Ctse T C 1: 131,668,139 Y190H probably damaging Het
Cyp2d34 T A 15: 82,620,787 D24V possibly damaging Het
D630045J12Rik A T 6: 38,190,723 Y981* probably null Het
Dclre1a G A 19: 56,544,950 T404I possibly damaging Het
Dmc1 T C 15: 79,601,545 D23G probably damaging Het
Dnah8 C T 17: 30,840,713 T4429M probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fn3k A T 11: 121,439,311 M107L probably benign Het
Fxyd5 A G 7: 31,041,429 L10P probably damaging Het
Gm4922 C T 10: 18,784,012 D321N probably benign Het
Gm7714 T C 5: 88,282,524 V93A possibly damaging Het
Gm884 T C 11: 103,543,315 I3009M unknown Het
Gtf2h3 A G 5: 124,595,987 *310W probably null Het
Hapln2 G A 3: 88,023,544 T180I possibly damaging Het
Herc1 T G 9: 66,487,950 V4189G probably damaging Het
Iqgap1 A G 7: 80,730,127 V1166A probably damaging Het
Kcnk10 T C 12: 98,435,099 N439S Het
Klhl3 A T 13: 58,113,154 M15K Het
Klk1b26 A T 7: 44,016,120 T151S probably benign Het
Krtap5-1 C A 7: 142,296,462 C176F unknown Het
Krtap5-3 T A 7: 142,201,956 C177S unknown Het
Map1a T C 2: 121,299,020 F180L probably damaging Het
Mfap5 T C 6: 122,521,930 probably null Het
Nckap1 T A 2: 80,524,664 H638L possibly damaging Het
Olfr506 T A 7: 108,612,943 I212N probably benign Het
Olfr910 T G 9: 38,539,348 M151R noncoding transcript Het
Optc C T 1: 133,905,072 V97M probably benign Het
Piezo1 A G 8: 122,501,559 Y330H Het
Ppp1r12b G T 1: 134,876,148 N424K probably benign Het
Prdm5 T A 6: 65,936,074 F580L probably damaging Het
Prr27 A C 5: 87,846,312 K348N possibly damaging Het
Prr30 A G 14: 101,198,386 Y247H possibly damaging Het
Sec24d T C 3: 123,305,886 V336A possibly damaging Het
Serac1 A T 17: 6,050,758 L457H probably damaging Het
Serpina1f A G 12: 103,693,498 I175T probably damaging Het
Sspo A T 6: 48,449,963 H242L probably benign Het
Tcaf2 A T 6: 42,630,024 M332K probably benign Het
Trim43b G T 9: 89,085,405 H393N possibly damaging Het
Ush2a T C 1: 188,444,641 L1334S probably benign Het
Usp35 T C 7: 97,312,344 E625G probably benign Het
Other mutations in Tnrc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Tnrc6a APN 7 123170780 missense probably benign 0.04
IGL00580:Tnrc6a APN 7 123174278 missense probably damaging 1.00
IGL01309:Tnrc6a APN 7 123171494 missense probably benign 0.04
IGL02004:Tnrc6a APN 7 123181366 missense possibly damaging 0.57
IGL02142:Tnrc6a APN 7 123152191 intron probably benign
IGL02220:Tnrc6a APN 7 123170456 missense probably benign
IGL02436:Tnrc6a APN 7 123184215 nonsense probably null
IGL02670:Tnrc6a APN 7 123171312 missense possibly damaging 0.92
IGL02743:Tnrc6a APN 7 123171473 missense probably damaging 1.00
0152:Tnrc6a UTSW 7 123180654 missense probably damaging 1.00
R0008:Tnrc6a UTSW 7 123170394 missense probably benign 0.00
R0008:Tnrc6a UTSW 7 123170394 missense probably benign 0.00
R0369:Tnrc6a UTSW 7 123170860 missense probably damaging 1.00
R0512:Tnrc6a UTSW 7 123186728 splice site probably benign
R0566:Tnrc6a UTSW 7 123170913 missense probably benign 0.00
R0600:Tnrc6a UTSW 7 123171816 missense probably benign 0.14
R0751:Tnrc6a UTSW 7 123170340 missense possibly damaging 0.73
R1184:Tnrc6a UTSW 7 123170340 missense possibly damaging 0.73
R1319:Tnrc6a UTSW 7 123184251 missense probably benign 0.02
R1405:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R1405:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R1585:Tnrc6a UTSW 7 123176875 missense probably benign 0.08
R1709:Tnrc6a UTSW 7 123169982 missense probably benign 0.10
R1776:Tnrc6a UTSW 7 123171297 missense probably damaging 1.00
R1791:Tnrc6a UTSW 7 123192917 missense possibly damaging 0.47
R1807:Tnrc6a UTSW 7 123162446 splice site probably benign
R1876:Tnrc6a UTSW 7 123162446 splice site probably benign
R2010:Tnrc6a UTSW 7 123171046 missense probably benign 0.26
R2086:Tnrc6a UTSW 7 123162446 splice site probably benign
R2089:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2091:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2091:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2511:Tnrc6a UTSW 7 123171092 missense probably damaging 1.00
R2830:Tnrc6a UTSW 7 123192949 makesense probably null
R2850:Tnrc6a UTSW 7 123179800 missense probably damaging 1.00
R3916:Tnrc6a UTSW 7 123181384 missense probably damaging 1.00
R4028:Tnrc6a UTSW 7 123170121 missense probably damaging 1.00
R4235:Tnrc6a UTSW 7 123171680 missense probably benign 0.00
R4439:Tnrc6a UTSW 7 123152182 nonsense probably null
R4525:Tnrc6a UTSW 7 123179782 missense probably benign
R4578:Tnrc6a UTSW 7 123184221 missense possibly damaging 0.89
R4613:Tnrc6a UTSW 7 123184289 critical splice donor site probably null
R4711:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R4722:Tnrc6a UTSW 7 123192090 missense possibly damaging 0.78
R4746:Tnrc6a UTSW 7 123189997 missense probably damaging 1.00
R4892:Tnrc6a UTSW 7 123169911 missense probably damaging 1.00
R4942:Tnrc6a UTSW 7 123192613 missense probably damaging 0.99
R4967:Tnrc6a UTSW 7 123189872 missense probably damaging 1.00
R5064:Tnrc6a UTSW 7 123186723 critical splice donor site probably null
R5239:Tnrc6a UTSW 7 123186619 missense probably benign
R5604:Tnrc6a UTSW 7 123174236 missense probably damaging 0.97
R5805:Tnrc6a UTSW 7 123170076 missense probably damaging 0.97
R5942:Tnrc6a UTSW 7 123186665 missense probably damaging 1.00
R5988:Tnrc6a UTSW 7 123182380 missense probably damaging 0.96
R6212:Tnrc6a UTSW 7 123143742 splice site probably null
R6284:Tnrc6a UTSW 7 123171335 missense probably damaging 0.99
R6417:Tnrc6a UTSW 7 123171074 missense probably benign 0.01
R6420:Tnrc6a UTSW 7 123171074 missense probably benign 0.01
R6575:Tnrc6a UTSW 7 123169910 missense probably damaging 1.00
R6760:Tnrc6a UTSW 7 123171999 missense probably damaging 1.00
R6886:Tnrc6a UTSW 7 123187445 missense probably benign 0.17
R6968:Tnrc6a UTSW 7 123182427 missense probably benign 0.05
R7216:Tnrc6a UTSW 7 123171495 missense probably benign 0.01
R7260:Tnrc6a UTSW 7 123186590 missense probably benign 0.36
R7299:Tnrc6a UTSW 7 123170913 missense probably benign
R7322:Tnrc6a UTSW 7 123171508 missense probably benign 0.09
R7500:Tnrc6a UTSW 7 123173450 splice site probably null
R7872:Tnrc6a UTSW 7 123179834 missense probably damaging 0.99
R8313:Tnrc6a UTSW 7 123170713 missense possibly damaging 0.92
R8348:Tnrc6a UTSW 7 123192123 missense possibly damaging 0.65
R8390:Tnrc6a UTSW 7 123162571 missense probably damaging 0.97
R8448:Tnrc6a UTSW 7 123192123 missense possibly damaging 0.65
R8514:Tnrc6a UTSW 7 123184215 nonsense probably null
X0064:Tnrc6a UTSW 7 123169798 missense probably benign 0.28
Z1176:Tnrc6a UTSW 7 123162496 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTAGTACTGGCCCATGGG -3'
(R):5'- CCACTGAATGAAACCTTCTGTG -3'

Sequencing Primer
(F):5'- TTTCCCCATGGAGCCCTAATAAG -3'
(R):5'- CTGAATGAAACCTTCTGTGTACCAC -3'
Posted On2020-07-28