Incidental Mutation 'R8270:Krtap5-1'
ID639448
Institutional Source Beutler Lab
Gene Symbol Krtap5-1
Ensembl Gene ENSMUSG00000066100
Gene Namekeratin associated protein 5-1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R8270 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location142296334-142297118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 142296462 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 176 (C176F)
Ref Sequence ENSEMBL: ENSMUSP00000137356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084413] [ENSMUST00000188274]
Predicted Effect unknown
Transcript: ENSMUST00000084413
AA Change: C176F
SMART Domains Protein: ENSMUSP00000137356
Gene: ENSMUSG00000066100
AA Change: C176F

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 93 134 3.9e-5 PFAM
Pfam:Keratin_B2_2 112 159 1.8e-7 PFAM
Pfam:Keratin_B2_2 122 170 5e-5 PFAM
Pfam:Keratin_B2_2 150 194 1.3e-8 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000188274
AA Change: C203F
SMART Domains Protein: ENSMUSP00000139752
Gene: ENSMUSG00000066100
AA Change: C203F

DomainStartEndE-ValueType
low complexity region 3 226 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,503,044 T3044I probably damaging Het
Apbb1ip C T 2: 22,874,992 P562S unknown Het
Arhgap44 A G 11: 65,022,034 M477T possibly damaging Het
Arhgef12 T C 9: 42,971,058 T1497A probably benign Het
Atp5h T C 11: 115,416,872 D91G probably damaging Het
Atp6v0a4 A G 6: 38,074,229 F405L probably damaging Het
Bicc1 T A 10: 70,932,108 T893S probably damaging Het
Cacna1i T A 15: 80,373,634 C1122S probably damaging Het
Capn7 A G 14: 31,358,679 E369G probably damaging Het
Cass4 T A 2: 172,427,669 L557Q probably damaging Het
Cdh5 A G 8: 104,113,040 I48V probably benign Het
Crisp3 T C 17: 40,235,922 K35R probably benign Het
Csde1 G A 3: 103,038,755 A22T possibly damaging Het
Ctse T C 1: 131,668,139 Y190H probably damaging Het
Cyp2d34 T A 15: 82,620,787 D24V possibly damaging Het
D630045J12Rik A T 6: 38,190,723 Y981* probably null Het
Dclre1a G A 19: 56,544,950 T404I possibly damaging Het
Dmc1 T C 15: 79,601,545 D23G probably damaging Het
Dnah8 C T 17: 30,840,713 T4429M probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fn3k A T 11: 121,439,311 M107L probably benign Het
Fxyd5 A G 7: 31,041,429 L10P probably damaging Het
Gm4922 C T 10: 18,784,012 D321N probably benign Het
Gm7714 T C 5: 88,282,524 V93A possibly damaging Het
Gm884 T C 11: 103,543,315 I3009M unknown Het
Gtf2h3 A G 5: 124,595,987 *310W probably null Het
Hapln2 G A 3: 88,023,544 T180I possibly damaging Het
Herc1 T G 9: 66,487,950 V4189G probably damaging Het
Iqgap1 A G 7: 80,730,127 V1166A probably damaging Het
Kcnk10 T C 12: 98,435,099 N439S Het
Klhl3 A T 13: 58,113,154 M15K Het
Klk1b26 A T 7: 44,016,120 T151S probably benign Het
Krtap5-3 T A 7: 142,201,956 C177S unknown Het
Map1a T C 2: 121,299,020 F180L probably damaging Het
Mfap5 T C 6: 122,521,930 probably null Het
Nckap1 T A 2: 80,524,664 H638L possibly damaging Het
Olfr506 T A 7: 108,612,943 I212N probably benign Het
Olfr910 T G 9: 38,539,348 M151R noncoding transcript Het
Optc C T 1: 133,905,072 V97M probably benign Het
Piezo1 A G 8: 122,501,559 Y330H Het
Ppp1r12b G T 1: 134,876,148 N424K probably benign Het
Prdm5 T A 6: 65,936,074 F580L probably damaging Het
Prr27 A C 5: 87,846,312 K348N possibly damaging Het
Prr30 A G 14: 101,198,386 Y247H possibly damaging Het
Sec24d T C 3: 123,305,886 V336A possibly damaging Het
Serac1 A T 17: 6,050,758 L457H probably damaging Het
Serpina1f A G 12: 103,693,498 I175T probably damaging Het
Sspo A T 6: 48,449,963 H242L probably benign Het
Tcaf2 A T 6: 42,630,024 M332K probably benign Het
Tnrc6a T A 7: 123,170,071 N361K possibly damaging Het
Trim43b G T 9: 89,085,405 H393N possibly damaging Het
Ush2a T C 1: 188,444,641 L1334S probably benign Het
Usp35 T C 7: 97,312,344 E625G probably benign Het
Other mutations in Krtap5-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02799:Krtap5-1 UTSW 7 142296505 nonsense probably null
R0195:Krtap5-1 UTSW 7 142296697 missense unknown
R1903:Krtap5-1 UTSW 7 142296347 unclassified probably benign
R4020:Krtap5-1 UTSW 7 142296357 critical splice acceptor site probably null
R4812:Krtap5-1 UTSW 7 142296891 missense unknown
R5943:Krtap5-1 UTSW 7 142297051 missense unknown
R6672:Krtap5-1 UTSW 7 142296496 missense unknown
R7203:Krtap5-1 UTSW 7 142296562 missense unknown
R7729:Krtap5-1 UTSW 7 142296596 small deletion probably benign
R7740:Krtap5-1 UTSW 7 142296596 small deletion probably benign
R7840:Krtap5-1 UTSW 7 142296596 small deletion probably benign
Z1177:Krtap5-1 UTSW 7 142296960 missense unknown
Predicted Primers PCR Primer
(F):5'- GATAAACTGGAGGCCACAGCTG -3'
(R):5'- AAACCCTGCTGCTCTTCAG -3'

Sequencing Primer
(F):5'- CTGAGGAAGCAGTTCAGAGG -3'
(R):5'- TCAGTCCAGCTGCTGCAAG -3'
Posted On2020-07-28