Incidental Mutation 'R8270:Piezo1'
ID639450
Institutional Source Beutler Lab
Gene Symbol Piezo1
Ensembl Gene ENSMUSG00000014444
Gene Namepiezo-type mechanosensitive ion channel component 1
SynonymsFam38a, Piezo1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8270 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location122481698-122551329 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122501559 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 330 (Y330H)
Ref Sequence ENSEMBL: ENSMUSP00000114584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067252] [ENSMUST00000127664] [ENSMUST00000128383] [ENSMUST00000156333]
Predicted Effect probably benign
Transcript: ENSMUST00000067252
AA Change: Y329H

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000089777
Gene: ENSMUSG00000014444
AA Change: Y329H

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
low complexity region 156 169 N/A INTRINSIC
transmembrane domain 211 233 N/A INTRINSIC
transmembrane domain 248 270 N/A INTRINSIC
transmembrane domain 316 333 N/A INTRINSIC
low complexity region 353 368 N/A INTRINSIC
low complexity region 396 408 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
transmembrane domain 513 535 N/A INTRINSIC
internal_repeat_1 541 658 5.31e-5 PROSPERO
transmembrane domain 685 707 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
transmembrane domain 817 839 N/A INTRINSIC
transmembrane domain 844 866 N/A INTRINSIC
low complexity region 940 952 N/A INTRINSIC
transmembrane domain 979 1001 N/A INTRINSIC
transmembrane domain 1005 1022 N/A INTRINSIC
transmembrane domain 1035 1057 N/A INTRINSIC
transmembrane domain 1154 1171 N/A INTRINSIC
transmembrane domain 1178 1197 N/A INTRINSIC
Pfam:PIEZO 1229 1458 1.1e-97 PFAM
low complexity region 1475 1486 N/A INTRINSIC
internal_repeat_1 1646 1752 5.31e-5 PROSPERO
low complexity region 1905 1921 N/A INTRINSIC
transmembrane domain 1976 1998 N/A INTRINSIC
transmembrane domain 2018 2038 N/A INTRINSIC
transmembrane domain 2045 2067 N/A INTRINSIC
transmembrane domain 2077 2094 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2126 2544 3.2e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128383
SMART Domains Protein: ENSMUSP00000116194
Gene: ENSMUSG00000014444

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 31 53 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
transmembrane domain 247 269 N/A INTRINSIC
low complexity region 300 315 N/A INTRINSIC
transmembrane domain 379 401 N/A INTRINSIC
transmembrane domain 406 428 N/A INTRINSIC
low complexity region 502 514 N/A INTRINSIC
transmembrane domain 541 563 N/A INTRINSIC
transmembrane domain 567 584 N/A INTRINSIC
transmembrane domain 597 619 N/A INTRINSIC
transmembrane domain 716 733 N/A INTRINSIC
transmembrane domain 740 759 N/A INTRINSIC
transmembrane domain 774 796 N/A INTRINSIC
transmembrane domain 803 820 N/A INTRINSIC
low complexity region 848 859 N/A INTRINSIC
coiled coil region 895 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148497
SMART Domains Protein: ENSMUSP00000121725
Gene: ENSMUSG00000014444

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
transmembrane domain 165 187 N/A INTRINSIC
low complexity region 288 300 N/A INTRINSIC
transmembrane domain 351 373 N/A INTRINSIC
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 505 522 N/A INTRINSIC
transmembrane domain 529 548 N/A INTRINSIC
Pfam:PIEZO 580 809 3.2e-98 PFAM
low complexity region 826 837 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000114584
Gene: ENSMUSG00000014444
AA Change: Y330H

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
transmembrane domain 212 234 N/A INTRINSIC
transmembrane domain 249 271 N/A INTRINSIC
transmembrane domain 317 334 N/A INTRINSIC
low complexity region 354 369 N/A INTRINSIC
low complexity region 397 409 N/A INTRINSIC
transmembrane domain 434 456 N/A INTRINSIC
transmembrane domain 469 491 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
internal_repeat_1 542 659 4.88e-5 PROSPERO
transmembrane domain 686 708 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
transmembrane domain 845 867 N/A INTRINSIC
low complexity region 941 953 N/A INTRINSIC
transmembrane domain 980 1002 N/A INTRINSIC
transmembrane domain 1006 1023 N/A INTRINSIC
transmembrane domain 1036 1058 N/A INTRINSIC
transmembrane domain 1155 1172 N/A INTRINSIC
transmembrane domain 1179 1198 N/A INTRINSIC
Pfam:PIEZO 1230 1459 2.3e-94 PFAM
low complexity region 1476 1487 N/A INTRINSIC
internal_repeat_1 1647 1753 4.88e-5 PROSPERO
low complexity region 1906 1922 N/A INTRINSIC
transmembrane domain 1977 1999 N/A INTRINSIC
transmembrane domain 2019 2039 N/A INTRINSIC
transmembrane domain 2046 2068 N/A INTRINSIC
transmembrane domain 2078 2095 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2127 2545 8.7e-154 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mechanically-activated ion channel that links mechanical forces to biological signals. The encoded protein contains 36 transmembrane domains and functions as a homotetramer. Defects in this gene have been associated with dehydrated hereditary stomatocytosis. [provided by RefSeq, Jul 2015]
PHENOTYPE: Most mice homozygous for a gene trapped allele die at midgestation, exhibiting embryonic growth retardation, pericardial effusion, and vascular remodeling defects in the yolk sac and the embryo proper. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,503,044 T3044I probably damaging Het
Apbb1ip C T 2: 22,874,992 P562S unknown Het
Arhgap44 A G 11: 65,022,034 M477T possibly damaging Het
Arhgef12 T C 9: 42,971,058 T1497A probably benign Het
Atp5h T C 11: 115,416,872 D91G probably damaging Het
Atp6v0a4 A G 6: 38,074,229 F405L probably damaging Het
Bicc1 T A 10: 70,932,108 T893S probably damaging Het
Cacna1i T A 15: 80,373,634 C1122S probably damaging Het
Capn7 A G 14: 31,358,679 E369G probably damaging Het
Cass4 T A 2: 172,427,669 L557Q probably damaging Het
Cdh5 A G 8: 104,113,040 I48V probably benign Het
Crisp3 T C 17: 40,235,922 K35R probably benign Het
Csde1 G A 3: 103,038,755 A22T possibly damaging Het
Ctse T C 1: 131,668,139 Y190H probably damaging Het
Cyp2d34 T A 15: 82,620,787 D24V possibly damaging Het
D630045J12Rik A T 6: 38,190,723 Y981* probably null Het
Dclre1a G A 19: 56,544,950 T404I possibly damaging Het
Dmc1 T C 15: 79,601,545 D23G probably damaging Het
Dnah8 C T 17: 30,840,713 T4429M probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fn3k A T 11: 121,439,311 M107L probably benign Het
Fxyd5 A G 7: 31,041,429 L10P probably damaging Het
Gm4922 C T 10: 18,784,012 D321N probably benign Het
Gm7714 T C 5: 88,282,524 V93A possibly damaging Het
Gm884 T C 11: 103,543,315 I3009M unknown Het
Gtf2h3 A G 5: 124,595,987 *310W probably null Het
Hapln2 G A 3: 88,023,544 T180I possibly damaging Het
Herc1 T G 9: 66,487,950 V4189G probably damaging Het
Iqgap1 A G 7: 80,730,127 V1166A probably damaging Het
Kcnk10 T C 12: 98,435,099 N439S Het
Klhl3 A T 13: 58,113,154 M15K Het
Klk1b26 A T 7: 44,016,120 T151S probably benign Het
Krtap5-1 C A 7: 142,296,462 C176F unknown Het
Krtap5-3 T A 7: 142,201,956 C177S unknown Het
Map1a T C 2: 121,299,020 F180L probably damaging Het
Mfap5 T C 6: 122,521,930 probably null Het
Nckap1 T A 2: 80,524,664 H638L possibly damaging Het
Olfr506 T A 7: 108,612,943 I212N probably benign Het
Olfr910 T G 9: 38,539,348 M151R noncoding transcript Het
Optc C T 1: 133,905,072 V97M probably benign Het
Ppp1r12b G T 1: 134,876,148 N424K probably benign Het
Prdm5 T A 6: 65,936,074 F580L probably damaging Het
Prr27 A C 5: 87,846,312 K348N possibly damaging Het
Prr30 A G 14: 101,198,386 Y247H possibly damaging Het
Sec24d T C 3: 123,305,886 V336A possibly damaging Het
Serac1 A T 17: 6,050,758 L457H probably damaging Het
Serpina1f A G 12: 103,693,498 I175T probably damaging Het
Sspo A T 6: 48,449,963 H242L probably benign Het
Tcaf2 A T 6: 42,630,024 M332K probably benign Het
Tnrc6a T A 7: 123,170,071 N361K possibly damaging Het
Trim43b G T 9: 89,085,405 H393N possibly damaging Het
Ush2a T C 1: 188,444,641 L1334S probably benign Het
Usp35 T C 7: 97,312,344 E625G probably benign Het
Other mutations in Piezo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Piezo1 APN 8 122497870 missense possibly damaging 0.91
IGL01094:Piezo1 APN 8 122482138 missense probably damaging 0.99
IGL01321:Piezo1 APN 8 122487600 missense probably damaging 0.99
IGL01695:Piezo1 APN 8 122495509 missense possibly damaging 0.81
IGL01762:Piezo1 APN 8 122487929 nonsense probably null
IGL01922:Piezo1 APN 8 122492692 missense probably benign 0.41
IGL01953:Piezo1 APN 8 122491184 missense probably damaging 1.00
IGL01997:Piezo1 APN 8 122488331 splice site probably benign
IGL02381:Piezo1 APN 8 122498544 missense probably benign 0.28
IGL02398:Piezo1 APN 8 122486563 missense probably benign 0.21
IGL02562:Piezo1 APN 8 122496763 missense probably benign 0.11
IGL02572:Piezo1 APN 8 122485305 missense probably benign 0.28
IGL02691:Piezo1 APN 8 122501949 missense possibly damaging 0.58
IGL02726:Piezo1 APN 8 122487155 missense probably damaging 0.99
IGL02814:Piezo1 APN 8 122498215 missense probably damaging 1.00
IGL02931:Piezo1 APN 8 122483519 missense probably damaging 1.00
IGL03145:Piezo1 APN 8 122482921 missense probably benign 0.14
FR4449:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
FR4548:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
FR4737:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
FR4976:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
LCD18:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
R0085:Piezo1 UTSW 8 122501615 missense probably damaging 0.98
R0096:Piezo1 UTSW 8 122485370 unclassified probably benign
R0970:Piezo1 UTSW 8 122486810 missense possibly damaging 0.94
R1364:Piezo1 UTSW 8 122498571 missense possibly damaging 0.61
R1460:Piezo1 UTSW 8 122502151 missense possibly damaging 0.86
R1485:Piezo1 UTSW 8 122482049 missense probably damaging 1.00
R1538:Piezo1 UTSW 8 122491403 missense probably damaging 1.00
R1655:Piezo1 UTSW 8 122496822 missense probably benign 0.09
R1700:Piezo1 UTSW 8 122487502 missense probably damaging 1.00
R1860:Piezo1 UTSW 8 122495750 missense possibly damaging 0.90
R1861:Piezo1 UTSW 8 122495750 missense possibly damaging 0.90
R1899:Piezo1 UTSW 8 122482645 unclassified probably benign
R1899:Piezo1 UTSW 8 122489566 missense probably damaging 1.00
R1900:Piezo1 UTSW 8 122482645 unclassified probably benign
R2018:Piezo1 UTSW 8 122482712 missense probably benign 0.43
R2019:Piezo1 UTSW 8 122482712 missense probably benign 0.43
R2219:Piezo1 UTSW 8 122491488 missense probably benign 0.01
R2331:Piezo1 UTSW 8 122487266 splice site probably null
R3016:Piezo1 UTSW 8 122506027 critical splice donor site probably null
R3699:Piezo1 UTSW 8 122494903 missense probably damaging 1.00
R3700:Piezo1 UTSW 8 122494903 missense probably damaging 1.00
R3746:Piezo1 UTSW 8 122492638 missense probably damaging 1.00
R3905:Piezo1 UTSW 8 122482143 missense probably damaging 1.00
R4093:Piezo1 UTSW 8 122501160 critical splice donor site probably null
R4296:Piezo1 UTSW 8 122491127 missense probably damaging 1.00
R4396:Piezo1 UTSW 8 122498674 missense probably damaging 0.98
R4467:Piezo1 UTSW 8 122486396 missense probably benign 0.17
R4614:Piezo1 UTSW 8 122486411 missense probably benign 0.25
R4642:Piezo1 UTSW 8 122495454 missense probably damaging 1.00
R4688:Piezo1 UTSW 8 122488539 missense probably damaging 1.00
R4734:Piezo1 UTSW 8 122498206 missense probably damaging 1.00
R4749:Piezo1 UTSW 8 122486939 missense possibly damaging 0.48
R4749:Piezo1 UTSW 8 122498206 missense probably damaging 1.00
R4865:Piezo1 UTSW 8 122486921 missense probably damaging 1.00
R4869:Piezo1 UTSW 8 122487545 missense probably benign
R4962:Piezo1 UTSW 8 122486481 missense probably benign 0.41
R5026:Piezo1 UTSW 8 122486818 missense probably benign 0.11
R5418:Piezo1 UTSW 8 122486780 missense probably damaging 1.00
R5625:Piezo1 UTSW 8 122482960 missense probably benign 0.01
R5759:Piezo1 UTSW 8 122507655 missense probably damaging 0.98
R5864:Piezo1 UTSW 8 122486373 missense possibly damaging 0.75
R5898:Piezo1 UTSW 8 122487943 missense probably benign 0.00
R5948:Piezo1 UTSW 8 122483347 missense probably benign 0.01
R6052:Piezo1 UTSW 8 122506269 missense probably damaging 1.00
R6086:Piezo1 UTSW 8 122501657 missense possibly damaging 0.73
R6216:Piezo1 UTSW 8 122489130 missense probably benign 0.05
R6271:Piezo1 UTSW 8 122494932 missense probably damaging 1.00
R6549:Piezo1 UTSW 8 122500263 missense probably benign 0.02
R6723:Piezo1 UTSW 8 122507627 missense probably benign 0.15
R6871:Piezo1 UTSW 8 122485027 splice site probably null
R6919:Piezo1 UTSW 8 122490281 missense probably damaging 1.00
R7085:Piezo1 UTSW 8 122490894 missense
R7105:Piezo1 UTSW 8 122482118 missense unknown
R7267:Piezo1 UTSW 8 122497529 missense
R7337:Piezo1 UTSW 8 122485724 missense
R7381:Piezo1 UTSW 8 122501658 missense
R7480:Piezo1 UTSW 8 122498495 nonsense probably null
R7515:Piezo1 UTSW 8 122485296 missense
R7571:Piezo1 UTSW 8 122498418 missense
R7601:Piezo1 UTSW 8 122483481 splice site probably null
R7827:Piezo1 UTSW 8 122482920 missense probably damaging 0.96
R7923:Piezo1 UTSW 8 122496444 missense
R7975:Piezo1 UTSW 8 122495765 missense
R8071:Piezo1 UTSW 8 122487011 missense probably null
R8231:Piezo1 UTSW 8 122506097 missense
Predicted Primers PCR Primer
(F):5'- TGGTCCAGTTCCAGCTCATG -3'
(R):5'- ACACCATTTATCCAGGACATGTTACC -3'

Sequencing Primer
(F):5'- GCTCCTCATCCTCCCTGGG -3'
(R):5'- GGTAAGGCTTCCACACAGC -3'
Posted On2020-07-28