Incidental Mutation 'R8270:Trim43b'
ID639455
Institutional Source Beutler Lab
Gene Symbol Trim43b
Ensembl Gene ENSMUSG00000079162
Gene Nametripartite motif-containing 43B
SynonymsGm8269
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R8270 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location89084624-89092835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 89085405 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 393 (H393N)
Ref Sequence ENSEMBL: ENSMUSP00000126594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167113] [ENSMUST00000189557]
Predicted Effect possibly damaging
Transcript: ENSMUST00000167113
AA Change: H393N

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126594
Gene: ENSMUSG00000079162
AA Change: H393N

DomainStartEndE-ValueType
RING 16 56 9.6e-7 SMART
Blast:BBOX 88 129 4e-8 BLAST
PDB:2VOK|B 329 445 3e-15 PDB
Blast:SPRY 336 441 9e-20 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000189557
AA Change: H392N

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139457
Gene: ENSMUSG00000079162
AA Change: H392N

DomainStartEndE-ValueType
RING 16 56 4.7e-9 SMART
Blast:BBOX 88 129 4e-8 BLAST
SPRY 334 444 8.1e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,503,044 T3044I probably damaging Het
Apbb1ip C T 2: 22,874,992 P562S unknown Het
Arhgap44 A G 11: 65,022,034 M477T possibly damaging Het
Arhgef12 T C 9: 42,971,058 T1497A probably benign Het
Atp5h T C 11: 115,416,872 D91G probably damaging Het
Atp6v0a4 A G 6: 38,074,229 F405L probably damaging Het
Bicc1 T A 10: 70,932,108 T893S probably damaging Het
Cacna1i T A 15: 80,373,634 C1122S probably damaging Het
Capn7 A G 14: 31,358,679 E369G probably damaging Het
Cass4 T A 2: 172,427,669 L557Q probably damaging Het
Cdh5 A G 8: 104,113,040 I48V probably benign Het
Crisp3 T C 17: 40,235,922 K35R probably benign Het
Csde1 G A 3: 103,038,755 A22T possibly damaging Het
Ctse T C 1: 131,668,139 Y190H probably damaging Het
Cyp2d34 T A 15: 82,620,787 D24V possibly damaging Het
D630045J12Rik A T 6: 38,190,723 Y981* probably null Het
Dclre1a G A 19: 56,544,950 T404I possibly damaging Het
Dmc1 T C 15: 79,601,545 D23G probably damaging Het
Dnah8 C T 17: 30,840,713 T4429M probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fn3k A T 11: 121,439,311 M107L probably benign Het
Fxyd5 A G 7: 31,041,429 L10P probably damaging Het
Gm4922 C T 10: 18,784,012 D321N probably benign Het
Gm7714 T C 5: 88,282,524 V93A possibly damaging Het
Gm884 T C 11: 103,543,315 I3009M unknown Het
Gtf2h3 A G 5: 124,595,987 *310W probably null Het
Hapln2 G A 3: 88,023,544 T180I possibly damaging Het
Herc1 T G 9: 66,487,950 V4189G probably damaging Het
Iqgap1 A G 7: 80,730,127 V1166A probably damaging Het
Kcnk10 T C 12: 98,435,099 N439S Het
Klhl3 A T 13: 58,113,154 M15K Het
Klk1b26 A T 7: 44,016,120 T151S probably benign Het
Krtap5-1 C A 7: 142,296,462 C176F unknown Het
Krtap5-3 T A 7: 142,201,956 C177S unknown Het
Map1a T C 2: 121,299,020 F180L probably damaging Het
Mfap5 T C 6: 122,521,930 probably null Het
Nckap1 T A 2: 80,524,664 H638L possibly damaging Het
Olfr506 T A 7: 108,612,943 I212N probably benign Het
Olfr910 T G 9: 38,539,348 M151R noncoding transcript Het
Optc C T 1: 133,905,072 V97M probably benign Het
Piezo1 A G 8: 122,501,559 Y330H Het
Ppp1r12b G T 1: 134,876,148 N424K probably benign Het
Prdm5 T A 6: 65,936,074 F580L probably damaging Het
Prr27 A C 5: 87,846,312 K348N possibly damaging Het
Prr30 A G 14: 101,198,386 Y247H possibly damaging Het
Sec24d T C 3: 123,305,886 V336A possibly damaging Het
Serac1 A T 17: 6,050,758 L457H probably damaging Het
Serpina1f A G 12: 103,693,498 I175T probably damaging Het
Sspo A T 6: 48,449,963 H242L probably benign Het
Tcaf2 A T 6: 42,630,024 M332K probably benign Het
Tnrc6a T A 7: 123,170,071 N361K possibly damaging Het
Ush2a T C 1: 188,444,641 L1334S probably benign Het
Usp35 T C 7: 97,312,344 E625G probably benign Het
Other mutations in Trim43b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Trim43b APN 9 89091642 missense probably benign 0.04
IGL01953:Trim43b APN 9 89085443 missense possibly damaging 0.74
IGL02160:Trim43b APN 9 89091630 missense probably benign 0.35
IGL02626:Trim43b APN 9 89085488 missense possibly damaging 0.89
IGL03199:Trim43b APN 9 89089428 missense probably damaging 0.98
R0477:Trim43b UTSW 9 89090601 missense probably damaging 1.00
R1345:Trim43b UTSW 9 89085672 missense possibly damaging 0.77
R1491:Trim43b UTSW 9 89087612 missense possibly damaging 0.52
R1536:Trim43b UTSW 9 89085358 nonsense probably null
R1862:Trim43b UTSW 9 89085571 missense probably damaging 1.00
R2211:Trim43b UTSW 9 89085249 missense possibly damaging 0.91
R4039:Trim43b UTSW 9 89091347 missense probably damaging 1.00
R4222:Trim43b UTSW 9 89090639 missense probably benign 0.00
R4223:Trim43b UTSW 9 89090639 missense probably benign 0.00
R4224:Trim43b UTSW 9 89090639 missense probably benign 0.00
R4726:Trim43b UTSW 9 89089485 missense possibly damaging 0.70
R4812:Trim43b UTSW 9 89091480 missense probably benign 0.05
R4887:Trim43b UTSW 9 89091312 missense probably damaging 0.99
R5865:Trim43b UTSW 9 89085606 missense probably benign 0.19
R5909:Trim43b UTSW 9 89085398 missense possibly damaging 0.94
R6226:Trim43b UTSW 9 89091275 missense possibly damaging 0.82
R6378:Trim43b UTSW 9 89085399 missense probably benign 0.08
R6531:Trim43b UTSW 9 89085365 missense probably damaging 1.00
R7114:Trim43b UTSW 9 89085608 missense probably benign 0.04
R7946:Trim43b UTSW 9 89091485 missense probably damaging 0.98
R7972:Trim43b UTSW 9 89091308 missense probably damaging 1.00
V5622:Trim43b UTSW 9 89092545 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGCACTAGCATACTGGATTCCTATG -3'
(R):5'- TGAAACCCATCGTGTTTCCTGG -3'

Sequencing Primer
(F):5'- CCTATGATTATGTGTAGACAGCAGAG -3'
(R):5'- CTTCTCCAGGGGAAAATACTACTGG -3'
Posted On2020-07-28