Incidental Mutation 'R8270:Bicc1'
ID639457
Institutional Source Beutler Lab
Gene Symbol Bicc1
Ensembl Gene ENSMUSG00000014329
Gene NameBicC family RNA binding protein 1
SynonymsBic-C, jcpk
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8270 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location70922832-71159700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70932108 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 893 (T893S)
Ref Sequence ENSEMBL: ENSMUSP00000123201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014473] [ENSMUST00000131445] [ENSMUST00000143791]
Predicted Effect probably damaging
Transcript: ENSMUST00000014473
AA Change: T893S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000014473
Gene: ENSMUSG00000014329
AA Change: T893S

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 2.04e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000058942
Predicted Effect probably damaging
Transcript: ENSMUST00000131445
AA Change: T811S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119137
Gene: ENSMUSG00000014329
AA Change: T811S

DomainStartEndE-ValueType
SCOP:d1dtja_ 1 46 1e-2 SMART
Blast:KH 1 47 1e-22 BLAST
KH 51 124 6.24e-18 SMART
KH 203 273 1.25e-8 SMART
low complexity region 302 320 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
low complexity region 398 417 N/A INTRINSIC
low complexity region 618 636 N/A INTRINSIC
low complexity region 654 665 N/A INTRINSIC
low complexity region 712 733 N/A INTRINSIC
SAM 790 856 2.04e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143791
AA Change: T893S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123201
Gene: ENSMUSG00000014329
AA Change: T893S

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 4.26e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene causes heteroxia, impaired nodal flow, ventricular septal defects, partial prenatal lethality and postnatal death due to renal failure. Chemically induced mutants develop kidney cysts and may show bulging abdomens, bile duct anomalies and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,503,044 T3044I probably damaging Het
Apbb1ip C T 2: 22,874,992 P562S unknown Het
Arhgap44 A G 11: 65,022,034 M477T possibly damaging Het
Arhgef12 T C 9: 42,971,058 T1497A probably benign Het
Atp5h T C 11: 115,416,872 D91G probably damaging Het
Atp6v0a4 A G 6: 38,074,229 F405L probably damaging Het
Cacna1i T A 15: 80,373,634 C1122S probably damaging Het
Capn7 A G 14: 31,358,679 E369G probably damaging Het
Cass4 T A 2: 172,427,669 L557Q probably damaging Het
Cdh5 A G 8: 104,113,040 I48V probably benign Het
Crisp3 T C 17: 40,235,922 K35R probably benign Het
Csde1 G A 3: 103,038,755 A22T possibly damaging Het
Ctse T C 1: 131,668,139 Y190H probably damaging Het
Cyp2d34 T A 15: 82,620,787 D24V possibly damaging Het
D630045J12Rik A T 6: 38,190,723 Y981* probably null Het
Dclre1a G A 19: 56,544,950 T404I possibly damaging Het
Dmc1 T C 15: 79,601,545 D23G probably damaging Het
Dnah8 C T 17: 30,840,713 T4429M probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fn3k A T 11: 121,439,311 M107L probably benign Het
Fxyd5 A G 7: 31,041,429 L10P probably damaging Het
Gm4922 C T 10: 18,784,012 D321N probably benign Het
Gm7714 T C 5: 88,282,524 V93A possibly damaging Het
Gm884 T C 11: 103,543,315 I3009M unknown Het
Gtf2h3 A G 5: 124,595,987 *310W probably null Het
Hapln2 G A 3: 88,023,544 T180I possibly damaging Het
Herc1 T G 9: 66,487,950 V4189G probably damaging Het
Iqgap1 A G 7: 80,730,127 V1166A probably damaging Het
Kcnk10 T C 12: 98,435,099 N439S Het
Klhl3 A T 13: 58,113,154 M15K Het
Klk1b26 A T 7: 44,016,120 T151S probably benign Het
Krtap5-1 C A 7: 142,296,462 C176F unknown Het
Krtap5-3 T A 7: 142,201,956 C177S unknown Het
Map1a T C 2: 121,299,020 F180L probably damaging Het
Mfap5 T C 6: 122,521,930 probably null Het
Nckap1 T A 2: 80,524,664 H638L possibly damaging Het
Olfr506 T A 7: 108,612,943 I212N probably benign Het
Olfr910 T G 9: 38,539,348 M151R noncoding transcript Het
Optc C T 1: 133,905,072 V97M probably benign Het
Piezo1 A G 8: 122,501,559 Y330H Het
Ppp1r12b G T 1: 134,876,148 N424K probably benign Het
Prdm5 T A 6: 65,936,074 F580L probably damaging Het
Prr27 A C 5: 87,846,312 K348N possibly damaging Het
Prr30 A G 14: 101,198,386 Y247H possibly damaging Het
Sec24d T C 3: 123,305,886 V336A possibly damaging Het
Serac1 A T 17: 6,050,758 L457H probably damaging Het
Serpina1f A G 12: 103,693,498 I175T probably damaging Het
Sspo A T 6: 48,449,963 H242L probably benign Het
Tcaf2 A T 6: 42,630,024 M332K probably benign Het
Tnrc6a T A 7: 123,170,071 N361K possibly damaging Het
Trim43b G T 9: 89,085,405 H393N possibly damaging Het
Ush2a T C 1: 188,444,641 L1334S probably benign Het
Usp35 T C 7: 97,312,344 E625G probably benign Het
Other mutations in Bicc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Bicc1 APN 10 70961157 missense probably damaging 1.00
IGL01988:Bicc1 APN 10 70956176 missense probably damaging 1.00
IGL02686:Bicc1 APN 10 70943360 splice site probably benign
IGL02829:Bicc1 APN 10 70958880 missense probably damaging 1.00
IGL03276:Bicc1 APN 10 70953438 missense possibly damaging 0.76
IGL03354:Bicc1 APN 10 70946602 missense probably benign 0.00
artemis UTSW 10 71027954 missense probably damaging 0.99
Pebbles UTSW 10 70947900 missense possibly damaging 0.95
PIT1430001:Bicc1 UTSW 10 70957681 missense possibly damaging 0.94
R0095:Bicc1 UTSW 10 70961158 missense probably damaging 1.00
R0142:Bicc1 UTSW 10 70925370 missense probably damaging 1.00
R0184:Bicc1 UTSW 10 71079215 missense probably benign
R0469:Bicc1 UTSW 10 71079215 missense probably benign
R0485:Bicc1 UTSW 10 70925315 missense probably damaging 0.96
R0520:Bicc1 UTSW 10 70957190 missense probably damaging 0.96
R0884:Bicc1 UTSW 10 70958847 missense probably damaging 1.00
R1678:Bicc1 UTSW 10 70943518 missense probably damaging 1.00
R1892:Bicc1 UTSW 10 70958784 missense probably damaging 1.00
R1943:Bicc1 UTSW 10 71159523 missense probably damaging 1.00
R2220:Bicc1 UTSW 10 70950125 missense probably damaging 1.00
R2240:Bicc1 UTSW 10 70946803 critical splice donor site probably null
R2519:Bicc1 UTSW 10 70930644 missense probably damaging 1.00
R4362:Bicc1 UTSW 10 70943374 frame shift probably null
R4363:Bicc1 UTSW 10 70943374 frame shift probably null
R4419:Bicc1 UTSW 10 70946974 missense possibly damaging 0.73
R4697:Bicc1 UTSW 10 70953484 missense possibly damaging 0.87
R4728:Bicc1 UTSW 10 70935831 critical splice donor site probably null
R4765:Bicc1 UTSW 10 70940593 missense probably damaging 1.00
R4838:Bicc1 UTSW 10 70945316 missense possibly damaging 0.50
R5022:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5023:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5057:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5082:Bicc1 UTSW 10 70940522 missense probably benign 0.05
R5160:Bicc1 UTSW 10 70932236 missense probably damaging 1.00
R5294:Bicc1 UTSW 10 70947900 missense possibly damaging 0.95
R5639:Bicc1 UTSW 10 70940520 missense probably damaging 1.00
R5749:Bicc1 UTSW 10 70946969 missense probably benign 0.00
R6045:Bicc1 UTSW 10 70957081 nonsense probably null
R6128:Bicc1 UTSW 10 70940483 splice site probably null
R6277:Bicc1 UTSW 10 71027901 missense possibly damaging 0.74
R6389:Bicc1 UTSW 10 70958922 missense probably damaging 1.00
R7021:Bicc1 UTSW 10 70961148 missense probably damaging 0.99
R7101:Bicc1 UTSW 10 70930653 missense probably damaging 1.00
R7351:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7352:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7353:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7366:Bicc1 UTSW 10 70943386 missense probably benign 0.01
R7480:Bicc1 UTSW 10 70943476 missense probably damaging 1.00
R7541:Bicc1 UTSW 10 70946604 missense possibly damaging 0.82
R7544:Bicc1 UTSW 10 70956374 missense possibly damaging 0.89
R7555:Bicc1 UTSW 10 70956291 missense possibly damaging 0.75
R7663:Bicc1 UTSW 10 70946590 missense probably benign
R7671:Bicc1 UTSW 10 70957167 missense probably benign 0.01
R7747:Bicc1 UTSW 10 70946993 missense probably benign
R8129:Bicc1 UTSW 10 71079203 missense probably benign 0.01
RF013:Bicc1 UTSW 10 70935830 critical splice donor site probably null
X0028:Bicc1 UTSW 10 70945336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGGGGTACTTTTCTGTAAACCC -3'
(R):5'- TTCAATCGAACCGCCTTCAC -3'

Sequencing Primer
(F):5'- GTGTTACCACGCTATACCAAATAAG -3'
(R):5'- AACCGCCTTCACCCGTG -3'
Posted On2020-07-28