Incidental Mutation 'R8270:Kcnk10'
ID639462
Institutional Source Beutler Lab
Gene Symbol Kcnk10
Ensembl Gene ENSMUSG00000033854
Gene Namepotassium channel, subfamily K, member 10
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R8270 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location98429437-98578310 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98435099 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 439 (N439S)
Ref Sequence ENSEMBL: ENSMUSP00000105740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110113]
Predicted Effect
SMART Domains Protein: ENSMUSP00000105740
Gene: ENSMUSG00000033854
AA Change: N439S

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Ion_trans 55 207 9.3e-8 PFAM
Pfam:Ion_trans_2 126 204 3.3e-20 PFAM
Pfam:Ion_trans_2 223 321 8.5e-21 PFAM
low complexity region 449 462 N/A INTRINSIC
low complexity region 479 489 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of potassium channel proteins containing two pore-forming P domains. This channel is an open rectifier which primarily passes outward current under physiological K+ concentrations, and is stimulated strongly by arachidonic acid and to a lesser degree by membrane stretching, intracellular acidification, and general anaesthetics. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit normal glucose hyperpolarization of hypothalamic neurons in response to glucose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,503,044 T3044I probably damaging Het
Apbb1ip C T 2: 22,874,992 P562S unknown Het
Arhgap44 A G 11: 65,022,034 M477T possibly damaging Het
Arhgef12 T C 9: 42,971,058 T1497A probably benign Het
Atp5h T C 11: 115,416,872 D91G probably damaging Het
Atp6v0a4 A G 6: 38,074,229 F405L probably damaging Het
Bicc1 T A 10: 70,932,108 T893S probably damaging Het
Cacna1i T A 15: 80,373,634 C1122S probably damaging Het
Capn7 A G 14: 31,358,679 E369G probably damaging Het
Cass4 T A 2: 172,427,669 L557Q probably damaging Het
Cdh5 A G 8: 104,113,040 I48V probably benign Het
Crisp3 T C 17: 40,235,922 K35R probably benign Het
Csde1 G A 3: 103,038,755 A22T possibly damaging Het
Ctse T C 1: 131,668,139 Y190H probably damaging Het
Cyp2d34 T A 15: 82,620,787 D24V possibly damaging Het
D630045J12Rik A T 6: 38,190,723 Y981* probably null Het
Dclre1a G A 19: 56,544,950 T404I possibly damaging Het
Dmc1 T C 15: 79,601,545 D23G probably damaging Het
Dnah8 C T 17: 30,840,713 T4429M probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fn3k A T 11: 121,439,311 M107L probably benign Het
Fxyd5 A G 7: 31,041,429 L10P probably damaging Het
Gm4922 C T 10: 18,784,012 D321N probably benign Het
Gm7714 T C 5: 88,282,524 V93A possibly damaging Het
Gm884 T C 11: 103,543,315 I3009M unknown Het
Gtf2h3 A G 5: 124,595,987 *310W probably null Het
Hapln2 G A 3: 88,023,544 T180I possibly damaging Het
Herc1 T G 9: 66,487,950 V4189G probably damaging Het
Iqgap1 A G 7: 80,730,127 V1166A probably damaging Het
Klhl3 A T 13: 58,113,154 M15K Het
Klk1b26 A T 7: 44,016,120 T151S probably benign Het
Krtap5-1 C A 7: 142,296,462 C176F unknown Het
Krtap5-3 T A 7: 142,201,956 C177S unknown Het
Map1a T C 2: 121,299,020 F180L probably damaging Het
Mfap5 T C 6: 122,521,930 probably null Het
Nckap1 T A 2: 80,524,664 H638L possibly damaging Het
Olfr506 T A 7: 108,612,943 I212N probably benign Het
Olfr910 T G 9: 38,539,348 M151R noncoding transcript Het
Optc C T 1: 133,905,072 V97M probably benign Het
Piezo1 A G 8: 122,501,559 Y330H Het
Ppp1r12b G T 1: 134,876,148 N424K probably benign Het
Prdm5 T A 6: 65,936,074 F580L probably damaging Het
Prr27 A C 5: 87,846,312 K348N possibly damaging Het
Prr30 A G 14: 101,198,386 Y247H possibly damaging Het
Sec24d T C 3: 123,305,886 V336A possibly damaging Het
Serac1 A T 17: 6,050,758 L457H probably damaging Het
Serpina1f A G 12: 103,693,498 I175T probably damaging Het
Sspo A T 6: 48,449,963 H242L probably benign Het
Tcaf2 A T 6: 42,630,024 M332K probably benign Het
Tnrc6a T A 7: 123,170,071 N361K possibly damaging Het
Trim43b G T 9: 89,085,405 H393N possibly damaging Het
Ush2a T C 1: 188,444,641 L1334S probably benign Het
Usp35 T C 7: 97,312,344 E625G probably benign Het
Other mutations in Kcnk10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Kcnk10 APN 12 98518533 missense probably damaging 0.99
IGL01409:Kcnk10 APN 12 98490063 missense probably damaging 1.00
IGL02149:Kcnk10 APN 12 98518840 splice site probably benign
R0467:Kcnk10 UTSW 12 98489945 missense probably benign 0.43
R0558:Kcnk10 UTSW 12 98436301 missense possibly damaging 0.89
R0665:Kcnk10 UTSW 12 98440685 missense probably benign 0.00
R1033:Kcnk10 UTSW 12 98518670 missense possibly damaging 0.93
R1036:Kcnk10 UTSW 12 98496186 splice site probably benign
R1398:Kcnk10 UTSW 12 98436226 missense probably damaging 0.99
R1482:Kcnk10 UTSW 12 98489948 missense probably damaging 0.99
R1675:Kcnk10 UTSW 12 98496288 missense probably benign 0.31
R2858:Kcnk10 UTSW 12 98435289 missense possibly damaging 0.64
R2871:Kcnk10 UTSW 12 98434813 missense probably benign 0.41
R2871:Kcnk10 UTSW 12 98434813 missense probably benign 0.41
R3736:Kcnk10 UTSW 12 98489912 missense probably benign 0.31
R3845:Kcnk10 UTSW 12 98440744 missense probably benign 0.11
R4077:Kcnk10 UTSW 12 98434946 missense probably benign 0.03
R4541:Kcnk10 UTSW 12 98436277 missense probably damaging 1.00
R4605:Kcnk10 UTSW 12 98489960 missense probably damaging 1.00
R4841:Kcnk10 UTSW 12 98434916 missense probably benign 0.00
R4842:Kcnk10 UTSW 12 98434916 missense probably benign 0.00
R4886:Kcnk10 UTSW 12 98435159 missense possibly damaging 0.89
R4968:Kcnk10 UTSW 12 98434902 missense probably benign 0.01
R4977:Kcnk10 UTSW 12 98440687 missense probably benign 0.07
R5108:Kcnk10 UTSW 12 98435301 missense probably benign 0.39
R5166:Kcnk10 UTSW 12 98434995 missense probably damaging 0.98
R5936:Kcnk10 UTSW 12 98489932 missense probably benign 0.12
R6193:Kcnk10 UTSW 12 98440772 missense probably benign 0.07
R7107:Kcnk10 UTSW 12 98518743 nonsense probably null
R7611:Kcnk10 UTSW 12 98518640 missense probably damaging 1.00
R7687:Kcnk10 UTSW 12 98435096 missense probably damaging 0.97
R8225:Kcnk10 UTSW 12 98440590 critical splice donor site probably null
X0067:Kcnk10 UTSW 12 98518824 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TACACTCTGTCAGCATGGC -3'
(R):5'- ACTATCCGAAGTATGGAGCGC -3'

Sequencing Primer
(F):5'- GCATGGCTGTGCTGGAG -3'
(R):5'- TGGGCTTGGACCAGAGG -3'
Posted On2020-07-28