Incidental Mutation 'R8270:Klhl3'
ID639464
Institutional Source Beutler Lab
Gene Symbol Klhl3
Ensembl Gene ENSMUSG00000014164
Gene Namekelch-like 3
SynonymsEG627648, 7530408C15Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8270 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location58000228-58113592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58113154 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 15 (M15K)
Ref Sequence ENSEMBL: ENSMUSP00000123701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160860]
Predicted Effect
SMART Domains Protein: ENSMUSP00000123701
Gene: ENSMUSG00000014164
AA Change: M15K

DomainStartEndE-ValueType
BTB 64 161 9.36e-30 SMART
BACK 166 268 7.49e-42 SMART
Kelch 316 361 3.31e-9 SMART
Kelch 362 408 3.82e-14 SMART
Kelch 409 455 1.49e-16 SMART
Kelch 456 504 8.58e-17 SMART
Kelch 505 551 4.93e-17 SMART
Kelch 552 599 4.16e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is ubiquitously expressed and encodes a full-length protein which has an N-terminal BTB domain followed by a BACK domain and six kelch-like repeats in the C-terminus. These kelch-like repeats promote substrate ubiquitination of bound proteins via interaction of the BTB domain with the CUL3 (cullin 3) component of a cullin-RING E3 ubiquitin ligase (CRL) complex. Muatations in this gene cause pseudohypoaldosteronism type IID (PHA2D); a rare Mendelian syndrome featuring hypertension, hyperkalaemia and metabolic acidosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice carrying a point mutation display salt-sensitive hypertension, hyperkalemia and metabolic acidosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,503,044 T3044I probably damaging Het
Apbb1ip C T 2: 22,874,992 P562S unknown Het
Arhgap44 A G 11: 65,022,034 M477T possibly damaging Het
Arhgef12 T C 9: 42,971,058 T1497A probably benign Het
Atp5h T C 11: 115,416,872 D91G probably damaging Het
Atp6v0a4 A G 6: 38,074,229 F405L probably damaging Het
Bicc1 T A 10: 70,932,108 T893S probably damaging Het
Cacna1i T A 15: 80,373,634 C1122S probably damaging Het
Capn7 A G 14: 31,358,679 E369G probably damaging Het
Cass4 T A 2: 172,427,669 L557Q probably damaging Het
Cdh5 A G 8: 104,113,040 I48V probably benign Het
Crisp3 T C 17: 40,235,922 K35R probably benign Het
Csde1 G A 3: 103,038,755 A22T possibly damaging Het
Ctse T C 1: 131,668,139 Y190H probably damaging Het
Cyp2d34 T A 15: 82,620,787 D24V possibly damaging Het
D630045J12Rik A T 6: 38,190,723 Y981* probably null Het
Dclre1a G A 19: 56,544,950 T404I possibly damaging Het
Dmc1 T C 15: 79,601,545 D23G probably damaging Het
Dnah8 C T 17: 30,840,713 T4429M probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fn3k A T 11: 121,439,311 M107L probably benign Het
Fxyd5 A G 7: 31,041,429 L10P probably damaging Het
Gm4922 C T 10: 18,784,012 D321N probably benign Het
Gm7714 T C 5: 88,282,524 V93A possibly damaging Het
Gm884 T C 11: 103,543,315 I3009M unknown Het
Gtf2h3 A G 5: 124,595,987 *310W probably null Het
Hapln2 G A 3: 88,023,544 T180I possibly damaging Het
Herc1 T G 9: 66,487,950 V4189G probably damaging Het
Iqgap1 A G 7: 80,730,127 V1166A probably damaging Het
Kcnk10 T C 12: 98,435,099 N439S Het
Klk1b26 A T 7: 44,016,120 T151S probably benign Het
Krtap5-1 C A 7: 142,296,462 C176F unknown Het
Krtap5-3 T A 7: 142,201,956 C177S unknown Het
Map1a T C 2: 121,299,020 F180L probably damaging Het
Mfap5 T C 6: 122,521,930 probably null Het
Nckap1 T A 2: 80,524,664 H638L possibly damaging Het
Olfr506 T A 7: 108,612,943 I212N probably benign Het
Olfr910 T G 9: 38,539,348 M151R noncoding transcript Het
Optc C T 1: 133,905,072 V97M probably benign Het
Piezo1 A G 8: 122,501,559 Y330H Het
Ppp1r12b G T 1: 134,876,148 N424K probably benign Het
Prdm5 T A 6: 65,936,074 F580L probably damaging Het
Prr27 A C 5: 87,846,312 K348N possibly damaging Het
Prr30 A G 14: 101,198,386 Y247H possibly damaging Het
Sec24d T C 3: 123,305,886 V336A possibly damaging Het
Serac1 A T 17: 6,050,758 L457H probably damaging Het
Serpina1f A G 12: 103,693,498 I175T probably damaging Het
Sspo A T 6: 48,449,963 H242L probably benign Het
Tcaf2 A T 6: 42,630,024 M332K probably benign Het
Tnrc6a T A 7: 123,170,071 N361K possibly damaging Het
Trim43b G T 9: 89,085,405 H393N possibly damaging Het
Ush2a T C 1: 188,444,641 L1334S probably benign Het
Usp35 T C 7: 97,312,344 E625G probably benign Het
Other mutations in Klhl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01790:Klhl3 APN 13 58009422 critical splice acceptor site probably null
IGL01984:Klhl3 APN 13 58011243 splice site probably benign
IGL02022:Klhl3 APN 13 58051064 missense possibly damaging 0.95
IGL02543:Klhl3 APN 13 58018871 missense probably damaging 1.00
bearded_dragon UTSW 13 58011152 missense probably benign 0.00
R0975:Klhl3 UTSW 13 58013863 missense possibly damaging 0.81
R1386:Klhl3 UTSW 13 58030433 missense probably damaging 0.99
R1588:Klhl3 UTSW 13 58013898 missense probably damaging 1.00
R1791:Klhl3 UTSW 13 58033230 missense possibly damaging 0.87
R1894:Klhl3 UTSW 13 58009375 missense probably damaging 1.00
R1953:Klhl3 UTSW 13 58011208 missense probably damaging 1.00
R2116:Klhl3 UTSW 13 58018991 missense probably damaging 0.99
R3114:Klhl3 UTSW 13 58051027 critical splice donor site probably null
R4082:Klhl3 UTSW 13 58018797 missense probably null 1.00
R4717:Klhl3 UTSW 13 58030516 missense probably damaging 1.00
R4857:Klhl3 UTSW 13 58018806 missense probably damaging 1.00
R4934:Klhl3 UTSW 13 58102417 nonsense probably null
R5112:Klhl3 UTSW 13 58018889 missense probably damaging 1.00
R5114:Klhl3 UTSW 13 58018967 missense probably benign 0.24
R5547:Klhl3 UTSW 13 58102429 splice site probably null
R5776:Klhl3 UTSW 13 58005184 missense probably benign 0.00
R6236:Klhl3 UTSW 13 58085062 missense probably damaging 1.00
R6268:Klhl3 UTSW 13 58013842 missense probably damaging 1.00
R6457:Klhl3 UTSW 13 58100378 missense probably benign 0.01
R6559:Klhl3 UTSW 13 58016476 missense probably damaging 1.00
R6580:Klhl3 UTSW 13 58018887 missense possibly damaging 0.75
R6601:Klhl3 UTSW 13 58095116 missense probably damaging 0.96
R6669:Klhl3 UTSW 13 58011152 missense probably benign 0.00
R6904:Klhl3 UTSW 13 58030445 missense probably damaging 1.00
R7652:Klhl3 UTSW 13 58113332 start gained probably benign
R7979:Klhl3 UTSW 13 58063797 missense probably benign 0.39
R8112:Klhl3 UTSW 13 58013863 missense possibly damaging 0.81
R8114:Klhl3 UTSW 13 58013863 missense possibly damaging 0.81
R8409:Klhl3 UTSW 13 58019428 missense probably damaging 1.00
Z1177:Klhl3 UTSW 13 58009409 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGAGACTTTTCTGCCCTCGC -3'
(R):5'- GGGTAAGACATTTTCTAGCACCG -3'

Sequencing Primer
(F):5'- CCTCGCTCTGCTTTGGGG -3'
(R):5'- CTTTTGCGGTAGAAGCCTGCC -3'
Posted On2020-07-28