Mutagenetix > Incidental Mutations

Incidental Mutation 'R8270:Cacna1i'

639469

Institutional Source

Beutler Lab

Gene Symbol

Cacna1i

Ensembl Gene

ENSMUSG00000022416

Gene Name

calcium channel, voltage-dependent, alpha 1I subunit

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8270 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80287238-80398279 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 80373634 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 1122 (C1122S)

Ref Sequence

ENSEMBL: ENSMUSP00000125063 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160424] [ENSMUST00000162155]

AlphaFold

E9Q7P2

Predicted Effect

probably damaging
Transcript: ENSMUST00000160424
AA Change: C1122S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000125063
Gene: ENSMUSG00000022416
AA Change: C1122S

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:Ion_trans	76	407	1.4e-79	PFAM
low complexity region	464	482	N/A	INTRINSIC
low complexity region	531	554	N/A	INTRINSIC
Pfam:Ion_trans	597	830	7.4e-58	PFAM
low complexity region	870	892	N/A	INTRINSIC
low complexity region	919	940	N/A	INTRINSIC
low complexity region	984	1015	N/A	INTRINSIC
low complexity region	1069	1080	N/A	INTRINSIC
Pfam:Ion_trans	1128	1401	7.8e-65	PFAM
Pfam:Ion_trans	1445	1700	9.4e-58	PFAM
Pfam:PKD_channel	1538	1694	1.4e-10	PFAM
low complexity region	1718	1739	N/A	INTRINSIC
low complexity region	1744	1760	N/A	INTRINSIC
low complexity region	1837	1853	N/A	INTRINSIC
low complexity region	1922	1933	N/A	INTRINSIC
low complexity region	1990	2005	N/A	INTRINSIC
low complexity region	2041	2058	N/A	INTRINSIC
low complexity region	2087	2097	N/A	INTRINSIC
low complexity region	2103	2126	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000162155
AA Change: C1122S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125229
Gene: ENSMUSG00000022416
AA Change: C1122S

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:Ion_trans	115	395	1.9e-66	PFAM
low complexity region	464	482	N/A	INTRINSIC
low complexity region	531	554	N/A	INTRINSIC
Pfam:Ion_trans	632	819	2.4e-45	PFAM
low complexity region	870	892	N/A	INTRINSIC
low complexity region	919	940	N/A	INTRINSIC
low complexity region	984	1015	N/A	INTRINSIC
low complexity region	1069	1080	N/A	INTRINSIC
Pfam:Ion_trans	1165	1389	6.2e-55	PFAM
coiled coil region	1394	1426	N/A	INTRINSIC
Pfam:Ion_trans	1480	1688	1.9e-47	PFAM
Pfam:PKD_channel	1538	1694	4.8e-10	PFAM
low complexity region	1718	1739	N/A	INTRINSIC
low complexity region	1744	1760	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.9%
20x: 99.6%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pore-forming alpha subunit of a voltage gated calcium channel. The encoded protein is a member of a subfamily of calcium channels referred to as is a low voltage-activated, T-type, calcium channel. The channel encoded by this protein is characterized by a slower activation and inactivation compared to other T-type calcium channels. This protein may be involved in calcium signaling in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	G	A	13: 81,503,044	T3044I	probably damaging	Het
Apbb1ip	C	T	2: 22,874,992	P562S	unknown	Het
Arhgap44	A	G	11: 65,022,034	M477T	possibly damaging	Het
Arhgef12	T	C	9: 42,971,058	T1497A	probably benign	Het
Atp5h	T	C	11: 115,416,872	D91G	probably damaging	Het
Atp6v0a4	A	G	6: 38,074,229	F405L	probably damaging	Het
Bicc1	T	A	10: 70,932,108	T893S	probably damaging	Het
Capn7	A	G	14: 31,358,679	E369G	probably damaging	Het
Cass4	T	A	2: 172,427,669	L557Q	probably damaging	Het
Cdh5	A	G	8: 104,113,040	I48V	probably benign	Het
Crisp3	T	C	17: 40,235,922	K35R	probably benign	Het
Csde1	G	A	3: 103,038,755	A22T	possibly damaging	Het
Ctse	T	C	1: 131,668,139	Y190H	probably damaging	Het
Cyp2d34	T	A	15: 82,620,787	D24V	possibly damaging	Het
D630045J12Rik	A	T	6: 38,190,723	Y981*	probably null	Het
Dclre1a	G	A	19: 56,544,950	T404I	possibly damaging	Het
Dmc1	T	C	15: 79,601,545	D23G	probably damaging	Het
Dnah8	C	T	17: 30,840,713	T4429M	probably damaging	Het
Esf1	A	T	2: 140,155,113		probably benign	Het
Fbxl12	C	A	9: 20,638,864	R165L	possibly damaging	Het
Fn3k	A	T	11: 121,439,311	M107L	probably benign	Het
Fxyd5	A	G	7: 31,041,429	L10P	probably damaging	Het
Gm21958	G	A	3: 54,714,212		probably benign	Het
Gm4922	C	T	10: 18,784,012	D321N	probably benign	Het
Gm7714	T	C	5: 88,282,524	V93A	possibly damaging	Het
Gm884	T	C	11: 103,543,315	I3009M	unknown	Het
Gtf2h3	A	G	5: 124,595,987	*310W	probably null	Het
Hapln2	G	A	3: 88,023,544	T180I	possibly damaging	Het
Herc1	T	G	9: 66,487,950	V4189G	probably damaging	Het
Iqgap1	A	G	7: 80,730,127	V1166A	probably damaging	Het
Kcnk10	T	C	12: 98,435,099	N439S		Het
Klhl3	A	T	13: 58,113,154	M15K		Het
Klk1b26	A	T	7: 44,016,120	T151S	probably benign	Het
Krtap5-1	C	A	7: 142,296,462	C176F	unknown	Het
Krtap5-3	T	A	7: 142,201,956	C177S	unknown	Het
Map1a	T	C	2: 121,299,020	F180L	probably damaging	Het
Mfap5	T	C	6: 122,521,930		probably null	Het
Nckap1	T	A	2: 80,524,664	H638L	possibly damaging	Het
Olfr506	T	A	7: 108,612,943	I212N	probably benign	Het
Olfr910	T	G	9: 38,539,348	M151R	noncoding transcript	Het
Optc	C	T	1: 133,905,072	V97M	probably benign	Het
Piezo1	A	G	8: 122,501,559	Y330H		Het
Ppp1r12b	G	T	1: 134,876,148	N424K	probably benign	Het
Prdm5	T	A	6: 65,936,074	F580L	probably damaging	Het
Prr27	A	C	5: 87,846,312	K348N	possibly damaging	Het
Prr30	A	G	14: 101,198,386	Y247H	possibly damaging	Het
Rbks	A	T	5: 31,650,466		probably benign	Het
Sec24d	T	C	3: 123,305,886	V336A	possibly damaging	Het
Serac1	A	T	17: 6,050,758	L457H	probably damaging	Het
Serpina1f	A	G	12: 103,693,498	I175T	probably damaging	Het
Sspo	A	T	6: 48,449,963	H242L	probably benign	Het
Tcaf2	A	T	6: 42,630,024	M332K	probably benign	Het
Tnrc6a	T	A	7: 123,170,071	N361K	possibly damaging	Het
Trim43b	G	T	9: 89,085,405	H393N	possibly damaging	Het
Ush2a	T	C	1: 188,444,641	L1334S	probably benign	Het
Usp35	T	C	7: 97,312,344	E625G	probably benign	Het

Other mutations in Cacna1i

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Cacna1i	APN	15	80382019	missense	probably damaging	1.00
IGL00976:Cacna1i	APN	15	80355645	missense	probably benign
IGL01338:Cacna1i	APN	15	80348380	missense	probably damaging	0.99
IGL01589:Cacna1i	APN	15	80387759	splice site	probably benign
IGL01669:Cacna1i	APN	15	80391757	missense	probably benign
IGL01807:Cacna1i	APN	15	80374147	missense	probably damaging	1.00
IGL01911:Cacna1i	APN	15	80391732	missense	probably benign	0.09
IGL01973:Cacna1i	APN	15	80382033	missense	probably damaging	1.00
IGL02205:Cacna1i	APN	15	80372951	missense	probably benign	0.06
IGL02519:Cacna1i	APN	15	80361874	nonsense	probably null
IGL02648:Cacna1i	APN	15	80298638	missense	probably damaging	0.96
IGL03033:Cacna1i	APN	15	80362239	missense	probably damaging	0.98
IGL03214:Cacna1i	APN	15	80355716	missense	probably benign	0.30
R0067:Cacna1i	UTSW	15	80381172	missense	probably damaging	1.00
R0067:Cacna1i	UTSW	15	80381172	missense	probably damaging	1.00
R0295:Cacna1i	UTSW	15	80356211	missense	probably damaging	1.00
R0345:Cacna1i	UTSW	15	80372462	missense	probably damaging	0.98
R0415:Cacna1i	UTSW	15	80368830	splice site	probably benign
R0637:Cacna1i	UTSW	15	80372654	missense	probably damaging	0.99
R0638:Cacna1i	UTSW	15	80381080	missense	possibly damaging	0.94
R0840:Cacna1i	UTSW	15	80358949	missense	possibly damaging	0.85
R1463:Cacna1i	UTSW	15	80379054	missense	possibly damaging	0.96
R1528:Cacna1i	UTSW	15	80391774	splice site	probably null
R1563:Cacna1i	UTSW	15	80321188	missense	probably damaging	0.97
R1563:Cacna1i	UTSW	15	80389855	splice site	probably benign
R1573:Cacna1i	UTSW	15	80393668	splice site	probably null
R1654:Cacna1i	UTSW	15	80389210	missense	probably damaging	1.00
R1754:Cacna1i	UTSW	15	80371529	missense	probably damaging	0.99
R1794:Cacna1i	UTSW	15	80389122	missense	probably damaging	1.00
R1824:Cacna1i	UTSW	15	80376789	missense	possibly damaging	0.64
R1863:Cacna1i	UTSW	15	80358931	missense	probably damaging	1.00
R1885:Cacna1i	UTSW	15	80358944	missense	probably damaging	0.99
R1886:Cacna1i	UTSW	15	80358944	missense	probably damaging	0.99
R1899:Cacna1i	UTSW	15	80391642	missense	possibly damaging	0.91
R1907:Cacna1i	UTSW	15	80375264	missense	probably damaging	1.00
R1943:Cacna1i	UTSW	15	80395044	missense	probably benign
R2162:Cacna1i	UTSW	15	80356187	missense	probably damaging	1.00
R2888:Cacna1i	UTSW	15	80374767	missense	probably damaging	1.00
R3701:Cacna1i	UTSW	15	80381071	splice site	probably benign
R3702:Cacna1i	UTSW	15	80381071	splice site	probably benign
R3832:Cacna1i	UTSW	15	80356187	missense	probably damaging	1.00
R4852:Cacna1i	UTSW	15	80388479	missense	probably damaging	0.99
R4857:Cacna1i	UTSW	15	80369662	missense	probably damaging	1.00
R4950:Cacna1i	UTSW	15	80368671	missense	probably damaging	1.00
R4980:Cacna1i	UTSW	15	80348449	missense	probably damaging	0.97
R5217:Cacna1i	UTSW	15	80390840	missense	possibly damaging	0.94
R5437:Cacna1i	UTSW	15	80371529	missense	probably damaging	1.00
R5519:Cacna1i	UTSW	15	80371499	missense	probably damaging	1.00
R5642:Cacna1i	UTSW	15	80395078	missense	possibly damaging	0.47
R6217:Cacna1i	UTSW	15	80389132	missense	probably damaging	1.00
R6225:Cacna1i	UTSW	15	80321226	missense	probably damaging	1.00
R6251:Cacna1i	UTSW	15	80336682	missense	probably damaging	1.00
R6463:Cacna1i	UTSW	15	80355758	missense	probably damaging	0.97
R6490:Cacna1i	UTSW	15	80378247	missense	probably damaging	1.00
R6613:Cacna1i	UTSW	15	80321259	missense	probably damaging	1.00
R6884:Cacna1i	UTSW	15	80374809	missense	probably damaging	1.00
R6904:Cacna1i	UTSW	15	80374801	missense	probably damaging	1.00
R7017:Cacna1i	UTSW	15	80380470	missense	probably damaging	1.00
R7155:Cacna1i	UTSW	15	80395238	missense	probably benign	0.04
R7274:Cacna1i	UTSW	15	80376822	missense	possibly damaging	0.95
R7323:Cacna1i	UTSW	15	80391653	missense	possibly damaging	0.86
R7335:Cacna1i	UTSW	15	80375575	missense	probably damaging	1.00
R7571:Cacna1i	UTSW	15	80375336	missense	probably damaging	1.00
R7768:Cacna1i	UTSW	15	80381188	missense	probably damaging	1.00
R7820:Cacna1i	UTSW	15	80372372	missense	probably benign	0.00
R7987:Cacna1i	UTSW	15	80320352	splice site	probably null
R8150:Cacna1i	UTSW	15	80375339	missense	probably damaging	1.00
R8206:Cacna1i	UTSW	15	80389815	splice site	probably null
R8382:Cacna1i	UTSW	15	80376816	missense	probably damaging	0.99
R8501:Cacna1i	UTSW	15	80382046	critical splice donor site	probably null
R8518:Cacna1i	UTSW	15	80358894	nonsense	probably null
R8552:Cacna1i	UTSW	15	80320397	missense	possibly damaging	0.69
R8679:Cacna1i	UTSW	15	80375810	intron	probably benign
R8696:Cacna1i	UTSW	15	80381974	missense	probably damaging	0.98
R8887:Cacna1i	UTSW	15	80374693	missense	possibly damaging	0.91
R9274:Cacna1i	UTSW	15	80370153	missense	probably damaging	1.00
R9379:Cacna1i	UTSW	15	80375294	missense	probably damaging	1.00
X0022:Cacna1i	UTSW	15	80361962	missense	probably damaging	0.99
X0024:Cacna1i	UTSW	15	80362139	missense	probably benign	0.03
X0058:Cacna1i	UTSW	15	80379102	missense	probably damaging	1.00
Z1177:Cacna1i	UTSW	15	80381179	missense	possibly damaging	0.64
Z1177:Cacna1i	UTSW	15	80389383	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- CCTTAGGCAGATGGTGAATGG -3'
(R):5'- CTCAGATCTAGCAGCCTTCC -3'

Sequencing Primer
(F):5'- CTTAGGCAGATGGTGAATGGCTATAG -3'
(R):5'- GCATGCTAAGTGTGTCTGCC -3'

Posted On

2020-07-28