Incidental Mutation 'R8270:Dclre1a'
ID639474
Institutional Source Beutler Lab
Gene Symbol Dclre1a
Ensembl Gene ENSMUSG00000025077
Gene NameDNA cross-link repair 1A
Synonyms2810043H12Rik, SMN1a, SNM1, mSNM1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8270 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location56529167-56548222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 56544950 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 404 (T404I)
Ref Sequence ENSEMBL: ENSMUSP00000138290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071423] [ENSMUST00000182059] [ENSMUST00000182276] [ENSMUST00000183143]
Predicted Effect probably benign
Transcript: ENSMUST00000071423
SMART Domains Protein: ENSMUSP00000071370
Gene: ENSMUSG00000025078

DomainStartEndE-ValueType
Pfam:Thioredoxin_8 78 174 2.7e-14 PFAM
LY 216 258 8.44e0 SMART
Pfam:NHL 278 304 2.3e-9 PFAM
low complexity region 321 331 N/A INTRINSIC
Blast:LY 402 446 5e-8 BLAST
LY 467 509 1.91e0 SMART
Pfam:NHL 530 558 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182059
Predicted Effect possibly damaging
Transcript: ENSMUST00000182276
AA Change: T404I

PolyPhen 2 Score 0.612 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138290
Gene: ENSMUSG00000025077
AA Change: T404I

DomainStartEndE-ValueType
low complexity region 90 110 N/A INTRINSIC
low complexity region 211 220 N/A INTRINSIC
low complexity region 546 560 N/A INTRINSIC
Lactamase_B 705 853 7.86e-1 SMART
Pfam:DRMBL 921 1027 1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183143
SMART Domains Protein: ENSMUSP00000138537
Gene: ENSMUSG00000025077

DomainStartEndE-ValueType
low complexity region 90 110 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved protein that is involved in the repair of DNA interstrand cross-links. DNA cross-links suppress transcription, replication, and DNA segregation. The encoded protein is a regulator of the mitotic cell cycle checkpoint. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile but exhibit increased sensitivity to the DNA interstrand cross-linking agent mitomycin C. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,503,044 T3044I probably damaging Het
Apbb1ip C T 2: 22,874,992 P562S unknown Het
Arhgap44 A G 11: 65,022,034 M477T possibly damaging Het
Arhgef12 T C 9: 42,971,058 T1497A probably benign Het
Atp5h T C 11: 115,416,872 D91G probably damaging Het
Atp6v0a4 A G 6: 38,074,229 F405L probably damaging Het
Bicc1 T A 10: 70,932,108 T893S probably damaging Het
Cacna1i T A 15: 80,373,634 C1122S probably damaging Het
Capn7 A G 14: 31,358,679 E369G probably damaging Het
Cass4 T A 2: 172,427,669 L557Q probably damaging Het
Cdh5 A G 8: 104,113,040 I48V probably benign Het
Crisp3 T C 17: 40,235,922 K35R probably benign Het
Csde1 G A 3: 103,038,755 A22T possibly damaging Het
Ctse T C 1: 131,668,139 Y190H probably damaging Het
Cyp2d34 T A 15: 82,620,787 D24V possibly damaging Het
D630045J12Rik A T 6: 38,190,723 Y981* probably null Het
Dmc1 T C 15: 79,601,545 D23G probably damaging Het
Dnah8 C T 17: 30,840,713 T4429M probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fn3k A T 11: 121,439,311 M107L probably benign Het
Fxyd5 A G 7: 31,041,429 L10P probably damaging Het
Gm4922 C T 10: 18,784,012 D321N probably benign Het
Gm7714 T C 5: 88,282,524 V93A possibly damaging Het
Gm884 T C 11: 103,543,315 I3009M unknown Het
Gtf2h3 A G 5: 124,595,987 *310W probably null Het
Hapln2 G A 3: 88,023,544 T180I possibly damaging Het
Herc1 T G 9: 66,487,950 V4189G probably damaging Het
Iqgap1 A G 7: 80,730,127 V1166A probably damaging Het
Kcnk10 T C 12: 98,435,099 N439S Het
Klhl3 A T 13: 58,113,154 M15K Het
Klk1b26 A T 7: 44,016,120 T151S probably benign Het
Krtap5-1 C A 7: 142,296,462 C176F unknown Het
Krtap5-3 T A 7: 142,201,956 C177S unknown Het
Map1a T C 2: 121,299,020 F180L probably damaging Het
Mfap5 T C 6: 122,521,930 probably null Het
Nckap1 T A 2: 80,524,664 H638L possibly damaging Het
Olfr506 T A 7: 108,612,943 I212N probably benign Het
Olfr910 T G 9: 38,539,348 M151R noncoding transcript Het
Optc C T 1: 133,905,072 V97M probably benign Het
Piezo1 A G 8: 122,501,559 Y330H Het
Ppp1r12b G T 1: 134,876,148 N424K probably benign Het
Prdm5 T A 6: 65,936,074 F580L probably damaging Het
Prr27 A C 5: 87,846,312 K348N possibly damaging Het
Prr30 A G 14: 101,198,386 Y247H possibly damaging Het
Sec24d T C 3: 123,305,886 V336A possibly damaging Het
Serac1 A T 17: 6,050,758 L457H probably damaging Het
Serpina1f A G 12: 103,693,498 I175T probably damaging Het
Sspo A T 6: 48,449,963 H242L probably benign Het
Tcaf2 A T 6: 42,630,024 M332K probably benign Het
Tnrc6a T A 7: 123,170,071 N361K possibly damaging Het
Trim43b G T 9: 89,085,405 H393N possibly damaging Het
Ush2a T C 1: 188,444,641 L1334S probably benign Het
Usp35 T C 7: 97,312,344 E625G probably benign Het
Other mutations in Dclre1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Dclre1a APN 19 56547057 missense probably damaging 1.00
IGL02113:Dclre1a APN 19 56541532 missense probably damaging 0.98
IGL02264:Dclre1a APN 19 56544293 missense possibly damaging 0.93
IGL03303:Dclre1a APN 19 56546766 missense possibly damaging 0.85
Gof UTSW 19 56542709 missense probably damaging 1.00
Hoopla UTSW 19 56546635 critical splice donor site probably null
FR4589:Dclre1a UTSW 19 56544123 utr 3 prime probably benign
PIT4377001:Dclre1a UTSW 19 56544405 missense probably benign 0.05
R0081:Dclre1a UTSW 19 56542707 missense probably damaging 1.00
R0355:Dclre1a UTSW 19 56546635 critical splice donor site probably null
R0422:Dclre1a UTSW 19 56544135 nonsense probably null
R0486:Dclre1a UTSW 19 56541490 splice site probably benign
R0619:Dclre1a UTSW 19 56545409 missense probably benign 0.00
R0639:Dclre1a UTSW 19 56538440 missense probably damaging 1.00
R1221:Dclre1a UTSW 19 56531268 missense possibly damaging 0.69
R1352:Dclre1a UTSW 19 56545163 missense probably damaging 1.00
R1824:Dclre1a UTSW 19 56546718 splice site probably null
R1833:Dclre1a UTSW 19 56541500 splice site probably null
R3851:Dclre1a UTSW 19 56541507 missense probably damaging 1.00
R3889:Dclre1a UTSW 19 56545320 missense probably benign 0.00
R4373:Dclre1a UTSW 19 56545442 missense probably benign 0.04
R5277:Dclre1a UTSW 19 56544732 missense possibly damaging 0.78
R5747:Dclre1a UTSW 19 56541532 missense probably damaging 0.98
R5792:Dclre1a UTSW 19 56529590 missense probably damaging 1.00
R5892:Dclre1a UTSW 19 56547140 missense probably benign 0.29
R5993:Dclre1a UTSW 19 56542737 missense probably damaging 1.00
R6368:Dclre1a UTSW 19 56546791 missense probably benign 0.02
R6706:Dclre1a UTSW 19 56545069 missense probably benign 0.11
R6944:Dclre1a UTSW 19 56545019 missense possibly damaging 0.90
R6960:Dclre1a UTSW 19 56542709 missense probably damaging 1.00
R7023:Dclre1a UTSW 19 56540206 missense probably damaging 0.99
R7213:Dclre1a UTSW 19 56529635 missense probably damaging 1.00
R7355:Dclre1a UTSW 19 56547135 missense possibly damaging 0.53
R7413:Dclre1a UTSW 19 56542650 missense probably damaging 1.00
R7577:Dclre1a UTSW 19 56529533 missense probably damaging 1.00
R7840:Dclre1a UTSW 19 56531252 missense probably damaging 1.00
R8303:Dclre1a UTSW 19 56542689 missense probably damaging 1.00
RF031:Dclre1a UTSW 19 56544132 utr 3 prime probably benign
RF046:Dclre1a UTSW 19 56544132 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- AGTCTGATTGCCAACAGCTG -3'
(R):5'- CTGGATGATTCACAGCAGGAAC -3'

Sequencing Primer
(F):5'- CTTGATGCAAGTGAGAGGAATTTTTC -3'
(R):5'- AAACCTTCATGGTCCCTC -3'
Posted On2020-07-28