Incidental Mutation 'R0691:Cdc42bpa'
ID 63948
Institutional Source Beutler Lab
Gene Symbol Cdc42bpa
Ensembl Gene ENSMUSG00000026490
Gene Name CDC42 binding protein kinase alpha
Synonyms DMPK-like, A930014J19Rik
MMRRC Submission 038876-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.834) question?
Stock # R0691 (G1)
Quality Score 155
Status Validated
Chromosome 1
Chromosomal Location 179788037-179993168 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 179972400 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1401 (T1401A)
Ref Sequence ENSEMBL: ENSMUSP00000106746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076687] [ENSMUST00000097450] [ENSMUST00000097453] [ENSMUST00000111117] [ENSMUST00000135056] [ENSMUST00000212756]
AlphaFold Q3UU96
Predicted Effect possibly damaging
Transcript: ENSMUST00000076687
AA Change: T1307A

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000075980
Gene: ENSMUSG00000026490
AA Change: T1307A

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
coiled coil region 435 588 N/A INTRINSIC
coiled coil region 632 735 N/A INTRINSIC
Pfam:DMPK_coil 800 860 2.7e-29 PFAM
C1 919 968 4.09e-7 SMART
PH 989 1109 6.02e-8 SMART
CNH 1134 1411 3.37e-17 SMART
low complexity region 1456 1468 N/A INTRINSIC
PBD 1477 1512 2.05e-10 SMART
low complexity region 1531 1546 N/A INTRINSIC
low complexity region 1567 1580 N/A INTRINSIC
low complexity region 1606 1620 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097450
AA Change: T1388A

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095059
Gene: ENSMUSG00000026490
AA Change: T1388A

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
coiled coil region 435 669 N/A INTRINSIC
coiled coil region 713 816 N/A INTRINSIC
Pfam:DMPK_coil 881 941 2.2e-29 PFAM
C1 1000 1049 4.09e-7 SMART
PH 1070 1190 6.02e-8 SMART
CNH 1215 1492 3.37e-17 SMART
low complexity region 1537 1549 N/A INTRINSIC
PBD 1558 1593 2.05e-10 SMART
low complexity region 1612 1627 N/A INTRINSIC
low complexity region 1648 1661 N/A INTRINSIC
low complexity region 1687 1701 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097453
AA Change: T1360A

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095062
Gene: ENSMUSG00000026490
AA Change: T1360A

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
coiled coil region 435 669 N/A INTRINSIC
coiled coil region 713 816 N/A INTRINSIC
Pfam:DMPK_coil 881 941 2.5e-29 PFAM
C1 972 1021 4.09e-7 SMART
PH 1042 1162 6.02e-8 SMART
CNH 1187 1464 3.37e-17 SMART
low complexity region 1509 1521 N/A INTRINSIC
PBD 1530 1565 2.05e-10 SMART
low complexity region 1584 1599 N/A INTRINSIC
low complexity region 1620 1633 N/A INTRINSIC
low complexity region 1659 1673 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111117
AA Change: T1401A

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106746
Gene: ENSMUSG00000026490
AA Change: T1401A

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
low complexity region 484 499 N/A INTRINSIC
Pfam:KELK 529 608 1.1e-32 PFAM
coiled coil region 713 816 N/A INTRINSIC
Pfam:DMPK_coil 881 941 2.6e-29 PFAM
C1 1013 1062 4.09e-7 SMART
PH 1083 1203 6.02e-8 SMART
CNH 1228 1505 3.37e-17 SMART
low complexity region 1550 1562 N/A INTRINSIC
PBD 1571 1606 2.05e-10 SMART
low complexity region 1625 1640 N/A INTRINSIC
low complexity region 1661 1674 N/A INTRINSIC
low complexity region 1700 1714 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000133890
AA Change: T716A
SMART Domains Protein: ENSMUSP00000116337
Gene: ENSMUSG00000026490
AA Change: T716A

DomainStartEndE-ValueType
coiled coil region 6 109 N/A INTRINSIC
Pfam:DMPK_coil 175 235 1.4e-29 PFAM
C1 329 378 4.09e-7 SMART
PH 399 519 6.02e-8 SMART
CNH 544 821 3.37e-17 SMART
low complexity region 866 878 N/A INTRINSIC
PBD 887 922 2.05e-10 SMART
low complexity region 941 956 N/A INTRINSIC
low complexity region 977 990 N/A INTRINSIC
low complexity region 1016 1030 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000135056
AA Change: T617A

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114333
Gene: ENSMUSG00000026490
AA Change: T617A

DomainStartEndE-ValueType
Pfam:DMPK_coil 59 119 9e-30 PFAM
low complexity region 148 156 N/A INTRINSIC
C1 229 278 4.09e-7 SMART
PH 299 419 6.02e-8 SMART
CNH 444 721 3.37e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000212756
AA Change: T1417A

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect unknown
Transcript: ENSMUST00000143176
AA Change: T590A
SMART Domains Protein: ENSMUSP00000115261
Gene: ENSMUSG00000026490
AA Change: T590A

DomainStartEndE-ValueType
Pfam:DMPK_coil 84 144 1.3e-29 PFAM
C1 203 252 4.09e-7 SMART
PH 273 393 6.02e-8 SMART
CNH 418 695 3.37e-17 SMART
low complexity region 740 752 N/A INTRINSIC
PBD 761 796 1.02e-5 SMART
PBD 802 839 2.21e-1 SMART
low complexity region 877 892 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
low complexity region 952 966 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195719
Meta Mutation Damage Score 0.0741 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Serine/Threonine protein kinase family. This kinase contains multiple functional domains. Its kinase domain is highly similar to that of the myotonic dystrophy protein kinase (DMPK). This kinase also contains a Rac interactive binding (CRIB) domain, and has been shown to bind CDC42. It may function as a CDC42 downstream effector mediating CDC42 induced peripheral actin formation, and promoting cytoskeletal reorganization. Multiple alternatively spliced transcript variants have been described, and the full-length nature of two of them has been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,584,979 (GRCm39) D865G possibly damaging Het
Acy1 A T 9: 106,313,070 (GRCm39) probably null Het
Adcy4 A T 14: 56,010,104 (GRCm39) probably benign Het
Anpep T G 7: 79,489,047 (GRCm39) D347A probably damaging Het
Arhgap28 C T 17: 68,203,159 (GRCm39) probably null Het
Ccdc32 A G 2: 118,857,610 (GRCm39) probably benign Het
Celsr2 A G 3: 108,319,939 (GRCm39) Y958H probably damaging Het
Cenpe A G 3: 134,923,066 (GRCm39) E137G probably damaging Het
Chd8 T C 14: 52,450,890 (GRCm39) D1399G probably damaging Het
Cntn3 T C 6: 102,145,908 (GRCm39) T978A possibly damaging Het
Col10a1 A G 10: 34,271,692 (GRCm39) T555A possibly damaging Het
Crybg3 A C 16: 59,385,574 (GRCm39) probably null Het
Cts7 A G 13: 61,503,548 (GRCm39) F139L probably damaging Het
Dera T C 6: 137,773,745 (GRCm39) probably benign Het
Dgka A G 10: 128,559,129 (GRCm39) probably benign Het
Dhrs7 T A 12: 72,699,125 (GRCm39) I286F probably damaging Het
Dtwd2 A G 18: 49,861,424 (GRCm39) probably benign Het
Fermt1 A G 2: 132,748,653 (GRCm39) S657P probably damaging Het
Fhip2b T C 14: 70,825,727 (GRCm39) D351G probably damaging Het
Flnb T C 14: 7,890,810 (GRCm38) V564A probably benign Het
Garnl3 A G 2: 32,975,919 (GRCm39) F16L probably damaging Het
Gck T C 11: 5,856,691 (GRCm39) R191G probably damaging Het
Gucy1b1 A T 3: 81,952,941 (GRCm39) probably benign Het
Ifna2 A C 4: 88,601,895 (GRCm39) L41R probably damaging Het
Krt33a T G 11: 99,903,541 (GRCm39) E197A probably damaging Het
Lce1e G A 3: 92,615,063 (GRCm39) R95C unknown Het
Lct G T 1: 128,235,971 (GRCm39) S345R probably benign Het
Lrp2 A T 2: 69,281,724 (GRCm39) N3882K probably benign Het
Mcc G T 18: 44,578,927 (GRCm39) T652K possibly damaging Het
Mier1 A G 4: 102,996,699 (GRCm39) S109G probably benign Het
Nfat5 A G 8: 108,082,237 (GRCm39) N469S probably damaging Het
Or1e23 C A 11: 73,407,670 (GRCm39) M118I possibly damaging Het
Or6c214 G A 10: 129,591,271 (GRCm39) T16I probably damaging Het
Piwil1 G T 5: 128,820,371 (GRCm39) R256M probably null Het
Rgma T C 7: 73,059,160 (GRCm39) V88A probably damaging Het
Sdk2 T C 11: 113,685,746 (GRCm39) probably null Het
Sec22b A G 3: 97,819,990 (GRCm39) E94G probably damaging Het
Snrnp70 T C 7: 45,036,669 (GRCm39) R131G possibly damaging Het
Spata31d1a A G 13: 59,848,199 (GRCm39) S1310P possibly damaging Het
Spint1 A G 2: 119,076,948 (GRCm39) E344G probably damaging Het
Srrm1 G A 4: 135,052,302 (GRCm39) Q141* probably null Het
Tecta A T 9: 42,295,637 (GRCm39) L286Q probably damaging Het
Tep1 T A 14: 51,104,301 (GRCm39) K198* probably null Het
Tk2 A G 8: 104,957,824 (GRCm39) V174A probably benign Het
Txndc5 T C 13: 38,691,872 (GRCm39) K165E probably damaging Het
Ubr4 G A 4: 139,151,217 (GRCm39) R1884Q probably damaging Het
Vmn2r61 T C 7: 41,949,844 (GRCm39) Y755H probably damaging Het
Xrn1 T A 9: 95,855,592 (GRCm39) H296Q probably damaging Het
Zar1l A T 5: 150,436,407 (GRCm39) V223D probably damaging Het
Other mutations in Cdc42bpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Cdc42bpa APN 1 179,933,686 (GRCm39) missense probably damaging 1.00
IGL00807:Cdc42bpa APN 1 179,969,018 (GRCm39) missense possibly damaging 0.88
IGL00972:Cdc42bpa APN 1 179,902,249 (GRCm39) missense probably benign 0.00
IGL01084:Cdc42bpa APN 1 179,969,839 (GRCm39) splice site probably benign
IGL01149:Cdc42bpa APN 1 179,902,137 (GRCm39) missense probably damaging 0.99
IGL01377:Cdc42bpa APN 1 179,892,708 (GRCm39) missense probably damaging 1.00
IGL01541:Cdc42bpa APN 1 179,978,723 (GRCm39) critical splice acceptor site probably null
IGL01657:Cdc42bpa APN 1 179,939,431 (GRCm39) missense probably benign 0.05
IGL01720:Cdc42bpa APN 1 179,938,847 (GRCm39) missense probably damaging 1.00
IGL02227:Cdc42bpa APN 1 179,921,989 (GRCm39) missense possibly damaging 0.64
IGL02234:Cdc42bpa APN 1 179,978,756 (GRCm39) nonsense probably null
IGL02253:Cdc42bpa APN 1 179,859,161 (GRCm39) splice site probably benign
IGL02587:Cdc42bpa APN 1 179,921,510 (GRCm39) missense possibly damaging 0.91
IGL02671:Cdc42bpa APN 1 179,889,387 (GRCm39) missense probably benign
IGL02746:Cdc42bpa APN 1 179,939,312 (GRCm39) missense possibly damaging 0.91
IGL02756:Cdc42bpa APN 1 179,936,824 (GRCm39) missense possibly damaging 0.77
IGL02994:Cdc42bpa APN 1 179,827,002 (GRCm39) missense probably damaging 1.00
IGL03073:Cdc42bpa APN 1 179,921,941 (GRCm39) splice site probably benign
IGL03295:Cdc42bpa APN 1 179,977,769 (GRCm39) missense probably benign 0.00
P0022:Cdc42bpa UTSW 1 179,788,841 (GRCm39) missense probably damaging 0.99
PIT4142001:Cdc42bpa UTSW 1 179,859,125 (GRCm39) missense probably damaging 1.00
R0125:Cdc42bpa UTSW 1 179,788,763 (GRCm39) missense probably damaging 1.00
R0268:Cdc42bpa UTSW 1 179,983,347 (GRCm39) intron probably benign
R0472:Cdc42bpa UTSW 1 179,867,744 (GRCm39) missense probably damaging 1.00
R0492:Cdc42bpa UTSW 1 179,928,755 (GRCm39) missense probably benign 0.00
R0609:Cdc42bpa UTSW 1 179,867,744 (GRCm39) missense probably damaging 1.00
R0738:Cdc42bpa UTSW 1 179,827,027 (GRCm39) splice site probably benign
R1547:Cdc42bpa UTSW 1 179,902,209 (GRCm39) missense probably damaging 0.99
R1553:Cdc42bpa UTSW 1 179,921,540 (GRCm39) missense probably benign 0.01
R1601:Cdc42bpa UTSW 1 179,892,566 (GRCm39) nonsense probably null
R1709:Cdc42bpa UTSW 1 179,894,789 (GRCm39) missense probably damaging 1.00
R2101:Cdc42bpa UTSW 1 179,974,533 (GRCm39) missense probably benign 0.39
R2279:Cdc42bpa UTSW 1 179,864,484 (GRCm39) missense probably damaging 0.99
R2357:Cdc42bpa UTSW 1 179,894,792 (GRCm39) missense possibly damaging 0.81
R2373:Cdc42bpa UTSW 1 179,939,349 (GRCm39) missense possibly damaging 0.78
R2570:Cdc42bpa UTSW 1 179,977,742 (GRCm39) missense possibly damaging 0.84
R3709:Cdc42bpa UTSW 1 179,892,628 (GRCm39) missense probably damaging 1.00
R3710:Cdc42bpa UTSW 1 179,892,628 (GRCm39) missense probably damaging 1.00
R3816:Cdc42bpa UTSW 1 179,972,451 (GRCm39) missense possibly damaging 0.80
R3854:Cdc42bpa UTSW 1 179,983,543 (GRCm39) intron probably benign
R3855:Cdc42bpa UTSW 1 179,983,543 (GRCm39) intron probably benign
R3917:Cdc42bpa UTSW 1 179,933,719 (GRCm39) critical splice donor site probably null
R4604:Cdc42bpa UTSW 1 179,936,759 (GRCm39) missense probably benign 0.00
R4622:Cdc42bpa UTSW 1 179,902,223 (GRCm39) missense probably damaging 0.98
R4664:Cdc42bpa UTSW 1 179,972,130 (GRCm39) missense probably damaging 0.99
R4665:Cdc42bpa UTSW 1 179,972,130 (GRCm39) missense probably damaging 0.99
R4887:Cdc42bpa UTSW 1 179,972,200 (GRCm39) missense possibly damaging 0.61
R4989:Cdc42bpa UTSW 1 179,965,366 (GRCm39) missense probably damaging 0.99
R5033:Cdc42bpa UTSW 1 179,892,580 (GRCm39) missense probably damaging 1.00
R5050:Cdc42bpa UTSW 1 179,900,018 (GRCm39) nonsense probably null
R5077:Cdc42bpa UTSW 1 179,922,098 (GRCm39) intron probably benign
R5196:Cdc42bpa UTSW 1 179,899,978 (GRCm39) missense probably benign 0.09
R5276:Cdc42bpa UTSW 1 179,965,415 (GRCm39) missense probably damaging 1.00
R5313:Cdc42bpa UTSW 1 179,911,998 (GRCm39) missense probably benign
R5364:Cdc42bpa UTSW 1 179,894,747 (GRCm39) missense probably benign 0.06
R5372:Cdc42bpa UTSW 1 179,892,544 (GRCm39) missense probably damaging 1.00
R5405:Cdc42bpa UTSW 1 179,966,085 (GRCm39) missense possibly damaging 0.95
R5405:Cdc42bpa UTSW 1 179,894,894 (GRCm39) missense probably damaging 1.00
R5646:Cdc42bpa UTSW 1 179,933,659 (GRCm39) missense probably damaging 0.99
R5713:Cdc42bpa UTSW 1 179,911,975 (GRCm39) missense probably benign 0.03
R6012:Cdc42bpa UTSW 1 179,892,655 (GRCm39) missense probably damaging 1.00
R6029:Cdc42bpa UTSW 1 179,939,352 (GRCm39) missense probably damaging 1.00
R6378:Cdc42bpa UTSW 1 179,921,561 (GRCm39) missense possibly damaging 0.91
R6609:Cdc42bpa UTSW 1 179,928,839 (GRCm39) critical splice donor site probably null
R7122:Cdc42bpa UTSW 1 179,892,583 (GRCm39) missense probably damaging 1.00
R7289:Cdc42bpa UTSW 1 179,889,362 (GRCm39) nonsense probably null
R7670:Cdc42bpa UTSW 1 179,892,646 (GRCm39) missense probably damaging 1.00
R7912:Cdc42bpa UTSW 1 179,921,578 (GRCm39) missense probably damaging 1.00
R8139:Cdc42bpa UTSW 1 179,896,884 (GRCm39) missense probably damaging 1.00
R8362:Cdc42bpa UTSW 1 179,989,690 (GRCm39) missense probably damaging 0.98
R8378:Cdc42bpa UTSW 1 179,989,709 (GRCm39) missense probably damaging 0.98
R8794:Cdc42bpa UTSW 1 179,894,816 (GRCm39) missense probably damaging 1.00
R8835:Cdc42bpa UTSW 1 179,896,916 (GRCm39) missense probably damaging 1.00
R8896:Cdc42bpa UTSW 1 179,958,373 (GRCm39) intron probably benign
R9012:Cdc42bpa UTSW 1 179,859,077 (GRCm39) missense
R9110:Cdc42bpa UTSW 1 179,945,258 (GRCm39) missense possibly damaging 0.67
R9178:Cdc42bpa UTSW 1 179,958,401 (GRCm39) missense
R9184:Cdc42bpa UTSW 1 179,972,301 (GRCm39) missense probably benign 0.13
R9204:Cdc42bpa UTSW 1 179,939,460 (GRCm39) critical splice donor site probably null
R9227:Cdc42bpa UTSW 1 179,933,638 (GRCm39) missense probably benign
R9230:Cdc42bpa UTSW 1 179,933,638 (GRCm39) missense probably benign
R9299:Cdc42bpa UTSW 1 179,972,073 (GRCm39) missense probably damaging 1.00
R9366:Cdc42bpa UTSW 1 179,921,675 (GRCm39) missense probably damaging 1.00
R9381:Cdc42bpa UTSW 1 179,969,048 (GRCm39) missense probably damaging 0.97
R9461:Cdc42bpa UTSW 1 179,969,861 (GRCm39) missense probably damaging 1.00
R9559:Cdc42bpa UTSW 1 179,939,459 (GRCm39) critical splice donor site probably null
X0026:Cdc42bpa UTSW 1 179,788,763 (GRCm39) missense probably damaging 1.00
Z1176:Cdc42bpa UTSW 1 179,892,658 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTATGAACTGTTCCAAAGCAAGACC -3'
(R):5'- ACACTCACTGTACTAGGGGTGACAATG -3'

Sequencing Primer
(F):5'- CCAGGCACAGGAAGTTTAAGG -3'
(R):5'- TCCCAGTAGGTTTTCCACAGAAG -3'
Posted On 2013-07-30