Incidental Mutation 'R0691:Garnl3'
ID 63949
Institutional Source Beutler Lab
Gene Symbol Garnl3
Ensembl Gene ENSMUSG00000038860
Gene Name GTPase activating RANGAP domain-like 3
Synonyms
MMRRC Submission 038876-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.111) question?
Stock # R0691 (G1)
Quality Score 136
Status Validated
Chromosome 2
Chromosomal Location 32876236-33021666 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32975919 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 16 (F16L)
Ref Sequence ENSEMBL: ENSMUSP00000099874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049618] [ENSMUST00000102810] [ENSMUST00000124000] [ENSMUST00000127509] [ENSMUST00000133135] [ENSMUST00000137381]
AlphaFold Q3V0G7
Predicted Effect probably damaging
Transcript: ENSMUST00000049618
AA Change: F20L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057582
Gene: ENSMUSG00000038860
AA Change: F20L

DomainStartEndE-ValueType
Pfam:Rap_GAP 202 383 3.4e-73 PFAM
Pfam:CNH 475 780 3.5e-67 PFAM
low complexity region 793 804 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102810
AA Change: F16L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099874
Gene: ENSMUSG00000038860
AA Change: F16L

DomainStartEndE-ValueType
Pfam:Rap_GAP 198 385 4.6e-67 PFAM
Pfam:CNH 471 776 1.8e-68 PFAM
low complexity region 789 800 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000124000
AA Change: F101L

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123601
Gene: ENSMUSG00000038860
AA Change: F101L

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127509
Predicted Effect possibly damaging
Transcript: ENSMUST00000133135
AA Change: F61L

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135296
Predicted Effect probably damaging
Transcript: ENSMUST00000137381
AA Change: F61L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148043
Meta Mutation Damage Score 0.1021 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,584,979 (GRCm39) D865G possibly damaging Het
Acy1 A T 9: 106,313,070 (GRCm39) probably null Het
Adcy4 A T 14: 56,010,104 (GRCm39) probably benign Het
Anpep T G 7: 79,489,047 (GRCm39) D347A probably damaging Het
Arhgap28 C T 17: 68,203,159 (GRCm39) probably null Het
Ccdc32 A G 2: 118,857,610 (GRCm39) probably benign Het
Cdc42bpa A G 1: 179,972,400 (GRCm39) T1401A possibly damaging Het
Celsr2 A G 3: 108,319,939 (GRCm39) Y958H probably damaging Het
Cenpe A G 3: 134,923,066 (GRCm39) E137G probably damaging Het
Chd8 T C 14: 52,450,890 (GRCm39) D1399G probably damaging Het
Cntn3 T C 6: 102,145,908 (GRCm39) T978A possibly damaging Het
Col10a1 A G 10: 34,271,692 (GRCm39) T555A possibly damaging Het
Crybg3 A C 16: 59,385,574 (GRCm39) probably null Het
Cts7 A G 13: 61,503,548 (GRCm39) F139L probably damaging Het
Dera T C 6: 137,773,745 (GRCm39) probably benign Het
Dgka A G 10: 128,559,129 (GRCm39) probably benign Het
Dhrs7 T A 12: 72,699,125 (GRCm39) I286F probably damaging Het
Dtwd2 A G 18: 49,861,424 (GRCm39) probably benign Het
Fermt1 A G 2: 132,748,653 (GRCm39) S657P probably damaging Het
Fhip2b T C 14: 70,825,727 (GRCm39) D351G probably damaging Het
Flnb T C 14: 7,890,810 (GRCm38) V564A probably benign Het
Gck T C 11: 5,856,691 (GRCm39) R191G probably damaging Het
Gucy1b1 A T 3: 81,952,941 (GRCm39) probably benign Het
Ifna2 A C 4: 88,601,895 (GRCm39) L41R probably damaging Het
Krt33a T G 11: 99,903,541 (GRCm39) E197A probably damaging Het
Lce1e G A 3: 92,615,063 (GRCm39) R95C unknown Het
Lct G T 1: 128,235,971 (GRCm39) S345R probably benign Het
Lrp2 A T 2: 69,281,724 (GRCm39) N3882K probably benign Het
Mcc G T 18: 44,578,927 (GRCm39) T652K possibly damaging Het
Mier1 A G 4: 102,996,699 (GRCm39) S109G probably benign Het
Nfat5 A G 8: 108,082,237 (GRCm39) N469S probably damaging Het
Or1e23 C A 11: 73,407,670 (GRCm39) M118I possibly damaging Het
Or6c214 G A 10: 129,591,271 (GRCm39) T16I probably damaging Het
Piwil1 G T 5: 128,820,371 (GRCm39) R256M probably null Het
Rgma T C 7: 73,059,160 (GRCm39) V88A probably damaging Het
Sdk2 T C 11: 113,685,746 (GRCm39) probably null Het
Sec22b A G 3: 97,819,990 (GRCm39) E94G probably damaging Het
Snrnp70 T C 7: 45,036,669 (GRCm39) R131G possibly damaging Het
Spata31d1a A G 13: 59,848,199 (GRCm39) S1310P possibly damaging Het
Spint1 A G 2: 119,076,948 (GRCm39) E344G probably damaging Het
Srrm1 G A 4: 135,052,302 (GRCm39) Q141* probably null Het
Tecta A T 9: 42,295,637 (GRCm39) L286Q probably damaging Het
Tep1 T A 14: 51,104,301 (GRCm39) K198* probably null Het
Tk2 A G 8: 104,957,824 (GRCm39) V174A probably benign Het
Txndc5 T C 13: 38,691,872 (GRCm39) K165E probably damaging Het
Ubr4 G A 4: 139,151,217 (GRCm39) R1884Q probably damaging Het
Vmn2r61 T C 7: 41,949,844 (GRCm39) Y755H probably damaging Het
Xrn1 T A 9: 95,855,592 (GRCm39) H296Q probably damaging Het
Zar1l A T 5: 150,436,407 (GRCm39) V223D probably damaging Het
Other mutations in Garnl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Garnl3 APN 2 32,896,828 (GRCm39) missense probably damaging 1.00
IGL01601:Garnl3 APN 2 32,887,701 (GRCm39) nonsense probably null
IGL01981:Garnl3 APN 2 32,887,741 (GRCm39) missense probably damaging 0.98
IGL02209:Garnl3 APN 2 32,975,942 (GRCm39) missense probably damaging 0.99
IGL02434:Garnl3 APN 2 32,944,217 (GRCm39) missense probably damaging 1.00
IGL02512:Garnl3 APN 2 32,921,150 (GRCm39) missense probably damaging 1.00
IGL02947:Garnl3 APN 2 32,936,606 (GRCm39) missense probably damaging 1.00
PIT4403001:Garnl3 UTSW 2 32,880,770 (GRCm39) missense probably damaging 1.00
R0123:Garnl3 UTSW 2 32,896,816 (GRCm39) missense possibly damaging 0.92
R0134:Garnl3 UTSW 2 32,896,816 (GRCm39) missense possibly damaging 0.92
R0225:Garnl3 UTSW 2 32,896,816 (GRCm39) missense possibly damaging 0.92
R0551:Garnl3 UTSW 2 32,906,750 (GRCm39) missense probably damaging 1.00
R0693:Garnl3 UTSW 2 32,975,919 (GRCm39) missense probably damaging 1.00
R0737:Garnl3 UTSW 2 32,880,654 (GRCm39) missense probably damaging 0.98
R1350:Garnl3 UTSW 2 32,942,226 (GRCm39) missense probably damaging 1.00
R1691:Garnl3 UTSW 2 32,887,675 (GRCm39) nonsense probably null
R1791:Garnl3 UTSW 2 32,924,139 (GRCm39) missense probably benign 0.02
R1938:Garnl3 UTSW 2 32,895,212 (GRCm39) missense probably damaging 0.99
R2100:Garnl3 UTSW 2 32,936,657 (GRCm39) missense probably benign 0.35
R2316:Garnl3 UTSW 2 32,895,164 (GRCm39) missense probably damaging 1.00
R2353:Garnl3 UTSW 2 32,954,046 (GRCm39) missense probably damaging 1.00
R3161:Garnl3 UTSW 2 32,924,723 (GRCm39) missense probably damaging 1.00
R3839:Garnl3 UTSW 2 32,879,558 (GRCm39) missense probably benign 0.00
R3847:Garnl3 UTSW 2 32,882,240 (GRCm39) missense probably benign
R4871:Garnl3 UTSW 2 32,977,100 (GRCm39) start codon destroyed probably null 0.77
R5682:Garnl3 UTSW 2 32,944,185 (GRCm39) missense probably damaging 1.00
R5811:Garnl3 UTSW 2 32,896,911 (GRCm39) missense probably damaging 0.99
R6267:Garnl3 UTSW 2 32,994,892 (GRCm39) missense probably benign 0.20
R6502:Garnl3 UTSW 2 32,896,833 (GRCm39) missense possibly damaging 0.67
R6532:Garnl3 UTSW 2 32,921,131 (GRCm39) missense possibly damaging 0.87
R6639:Garnl3 UTSW 2 32,879,537 (GRCm39) missense possibly damaging 0.75
R6763:Garnl3 UTSW 2 32,944,208 (GRCm39) missense probably damaging 1.00
R6866:Garnl3 UTSW 2 32,892,785 (GRCm39) splice site probably null
R6913:Garnl3 UTSW 2 32,876,841 (GRCm39) missense possibly damaging 0.91
R7002:Garnl3 UTSW 2 32,944,205 (GRCm39) missense possibly damaging 0.65
R7168:Garnl3 UTSW 2 32,885,090 (GRCm39) missense probably damaging 1.00
R7341:Garnl3 UTSW 2 32,924,141 (GRCm39) missense probably damaging 1.00
R7746:Garnl3 UTSW 2 32,882,269 (GRCm39) missense probably damaging 1.00
R7919:Garnl3 UTSW 2 32,936,611 (GRCm39) missense probably benign 0.38
R8079:Garnl3 UTSW 2 32,908,511 (GRCm39) critical splice donor site probably null
R8087:Garnl3 UTSW 2 32,935,548 (GRCm39) missense probably benign 0.01
R8123:Garnl3 UTSW 2 32,994,950 (GRCm39) missense probably damaging 0.97
R8170:Garnl3 UTSW 2 32,905,235 (GRCm39) missense possibly damaging 0.88
R8347:Garnl3 UTSW 2 32,975,903 (GRCm39) missense probably damaging 1.00
R8418:Garnl3 UTSW 2 32,942,158 (GRCm39) missense possibly damaging 0.73
R8679:Garnl3 UTSW 2 32,916,106 (GRCm39) missense probably damaging 1.00
R8940:Garnl3 UTSW 2 32,895,241 (GRCm39) critical splice acceptor site probably null
R9081:Garnl3 UTSW 2 32,896,920 (GRCm39) missense possibly damaging 0.90
R9183:Garnl3 UTSW 2 32,895,080 (GRCm39) missense probably damaging 1.00
R9213:Garnl3 UTSW 2 32,895,080 (GRCm39) missense probably damaging 1.00
R9219:Garnl3 UTSW 2 32,975,898 (GRCm39) missense probably damaging 1.00
R9453:Garnl3 UTSW 2 32,893,881 (GRCm39) missense probably damaging 1.00
X0022:Garnl3 UTSW 2 32,912,680 (GRCm39) missense probably damaging 1.00
X0023:Garnl3 UTSW 2 32,916,161 (GRCm39) missense probably damaging 1.00
X0024:Garnl3 UTSW 2 32,895,191 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGACCATAACCTTTCAGCATCACTGAC -3'
(R):5'- CAAACCTGTTTCATAGCAGCCGTTTC -3'

Sequencing Primer
(F):5'- TCAGCATCACTGACTTAAATTAAACC -3'
(R):5'- GCCGTTTCTTtttctttttctctttc -3'
Posted On 2013-07-30