Incidental Mutation 'R8269:Ncan'
ID 639497
Institutional Source Beutler Lab
Gene Symbol Ncan
Ensembl Gene ENSMUSG00000002341
Gene Name neurocan
Synonyms Cspg3, Cspg3-rs, neurocan, Tgfbit
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8269 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 70093085-70120873 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 70107680 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 879 (Q879L)
Ref Sequence ENSEMBL: ENSMUSP00000002412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002412]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000002412
AA Change: Q879L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: Q879L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 30 N/A INTRINSIC
IG 43 157 9.63e-6 SMART
LINK 157 254 2.22e-56 SMART
LINK 258 356 4.72e-60 SMART
low complexity region 575 586 N/A INTRINSIC
low complexity region 602 632 N/A INTRINSIC
low complexity region 663 677 N/A INTRINSIC
EGF 963 996 6.5e-5 SMART
EGF_CA 998 1034 9.77e-9 SMART
CLECT 1040 1161 1.97e-41 SMART
CCP 1167 1223 2.53e-12 SMART
low complexity region 1225 1256 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T C 14: 8,246,325 T489A probably benign Het
Adgra3 A T 5: 49,963,737 C850S probably damaging Het
Ago3 T A 4: 126,376,928 K258* probably null Het
Akap11 G A 14: 78,513,378 T523I Het
Amigo2 G T 15: 97,246,231 N103K possibly damaging Het
Arfgap3 A C 15: 83,310,341 S377A probably benign Het
Arhgap39 G T 15: 76,751,742 Q98K probably benign Het
Atp1a4 T C 1: 172,232,325 D779G probably damaging Het
Bckdhb T C 9: 84,122,364 I388T probably benign Het
Ccdc144b A T 3: 36,046,713 N103K possibly damaging Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Cd109 A G 9: 78,665,682 K496R probably benign Het
Cnot1 A G 8: 95,751,761 F979L probably damaging Het
Cyb5r1 T A 1: 134,407,065 probably benign Het
D130040H23Rik T A 8: 69,303,148 S402T probably benign Het
Dmtf1 A T 5: 9,132,500 Y211* probably null Het
Dnah6 A G 6: 73,168,827 probably null Het
Emc10 G T 7: 44,491,984 Q227K possibly damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Exosc4 A T 15: 76,327,532 I14L probably benign Het
Fat2 T C 11: 55,282,709 T2393A possibly damaging Het
Flg2 A T 3: 93,201,880 H405L possibly damaging Het
Gin1 T A 1: 97,783,204 M204K probably damaging Het
Gm14085 C T 2: 122,521,688 H336Y probably damaging Het
Gnal A G 18: 67,135,622 D193G possibly damaging Het
Itpr3 G T 17: 27,093,284 R554L possibly damaging Het
Lipc A G 9: 70,820,373 L149P probably damaging Het
Lrrc37a A G 11: 103,497,898 Y2234H unknown Het
Lsm14b T C 2: 180,032,614 S317P probably damaging Het
Mapk4 G C 18: 73,930,551 F533L probably damaging Het
Mgll T A 6: 88,813,948 Y183* probably null Het
Mrrf T A 2: 36,147,961 D81E possibly damaging Het
Nox4 T G 7: 87,306,722 probably benign Het
Olfr1179 A T 2: 88,402,037 V299D probably damaging Het
Olfr492 A T 7: 108,323,569 C36S probably benign Het
Pcdhb10 A G 18: 37,414,009 K713E probably benign Het
Phkb A G 8: 86,029,582 D835G probably benign Het
Pld1 A G 3: 28,025,239 N63D probably benign Het
Pls1 G T 9: 95,761,970 T491K probably damaging Het
Plscr1 A G 9: 92,263,042 D35G unknown Het
Slc3a1 A G 17: 85,032,554 K180R probably benign Het
Suv39h1 G T X: 8,071,031 Q129K probably benign Het
Tbc1d8 A G 1: 39,426,088 V73A probably benign Het
Tmem161a T A 8: 70,181,958 V421E probably benign Het
Topbp1 C A 9: 103,328,593 P810Q possibly damaging Het
Ttc28 G A 5: 111,277,459 V1717M probably benign Het
Vmn2r55 T A 7: 12,670,658 T273S possibly damaging Het
Vwa5b2 A G 16: 20,604,438 D1062G probably damaging Het
Zcrb1 A G 15: 93,397,175 Y27H probably benign Het
Zfp128 G A 7: 12,890,736 G344R probably damaging Het
Other mutations in Ncan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ncan APN 8 70115271 missense probably benign 0.24
IGL00924:Ncan APN 8 70108389 missense possibly damaging 0.78
IGL01319:Ncan APN 8 70097562 missense probably damaging 0.99
IGL01407:Ncan APN 8 70101957 missense probably benign 0.17
IGL01528:Ncan APN 8 70110081 missense probably benign 0.00
IGL01567:Ncan APN 8 70108334 missense probably benign 0.09
IGL01808:Ncan APN 8 70107440 critical splice donor site probably null
IGL02543:Ncan APN 8 70108571 missense probably benign 0.37
IGL02551:Ncan APN 8 70102462 missense probably damaging 1.00
IGL02899:Ncan APN 8 70115048 missense possibly damaging 0.95
IGL02940:Ncan APN 8 70110085 missense probably benign 0.02
IGL03058:Ncan APN 8 70107932 missense possibly damaging 0.83
learned UTSW 8 70098081 nonsense probably null
sagacious UTSW 8 70112590 missense probably damaging 0.99
R0219:Ncan UTSW 8 70115334 missense probably benign 0.08
R0538:Ncan UTSW 8 70108602 missense possibly damaging 0.86
R0540:Ncan UTSW 8 70115159 missense possibly damaging 0.93
R0854:Ncan UTSW 8 70112552 missense probably damaging 1.00
R0918:Ncan UTSW 8 70108389 missense possibly damaging 0.78
R1344:Ncan UTSW 8 70108169 missense probably benign
R1575:Ncan UTSW 8 70110198 missense probably benign 0.27
R1739:Ncan UTSW 8 70108086 missense probably benign 0.03
R1847:Ncan UTSW 8 70102454 missense probably damaging 0.96
R1859:Ncan UTSW 8 70115348 missense possibly damaging 0.94
R2320:Ncan UTSW 8 70108218 missense probably benign
R2370:Ncan UTSW 8 70112813 missense probably benign 0.05
R3407:Ncan UTSW 8 70112151 missense probably damaging 1.00
R3408:Ncan UTSW 8 70112151 missense probably damaging 1.00
R3961:Ncan UTSW 8 70110300 missense probably benign 0.05
R4155:Ncan UTSW 8 70110077 missense possibly damaging 0.87
R4156:Ncan UTSW 8 70110077 missense possibly damaging 0.87
R4365:Ncan UTSW 8 70115211 missense probably damaging 1.00
R4858:Ncan UTSW 8 70104055 missense probably benign 0.00
R4925:Ncan UTSW 8 70109954 missense probably benign 0.02
R4942:Ncan UTSW 8 70100294 missense probably damaging 1.00
R4976:Ncan UTSW 8 70115025 missense probably damaging 0.98
R5119:Ncan UTSW 8 70115025 missense probably damaging 0.98
R5141:Ncan UTSW 8 70112837 missense probably damaging 1.00
R5679:Ncan UTSW 8 70112626 missense probably damaging 1.00
R5706:Ncan UTSW 8 70102017 missense probably damaging 0.99
R5915:Ncan UTSW 8 70098081 nonsense probably null
R6033:Ncan UTSW 8 70112590 missense probably damaging 0.99
R6033:Ncan UTSW 8 70112590 missense probably damaging 0.99
R6223:Ncan UTSW 8 70109954 missense probably benign 0.02
R6390:Ncan UTSW 8 70115249 missense probably benign 0.34
R6533:Ncan UTSW 8 70096357 missense probably benign 0.01
R6836:Ncan UTSW 8 70100315 missense possibly damaging 0.84
R6869:Ncan UTSW 8 70107907 missense probably benign 0.08
R7229:Ncan UTSW 8 70100311 missense possibly damaging 0.69
R7232:Ncan UTSW 8 70112088 missense probably damaging 1.00
R7293:Ncan UTSW 8 70115211 missense probably damaging 0.98
R7406:Ncan UTSW 8 70110099 missense probably benign 0.00
R7474:Ncan UTSW 8 70102041 missense possibly damaging 0.53
R7779:Ncan UTSW 8 70115011 missense probably damaging 0.99
R7973:Ncan UTSW 8 70097575 missense probably benign 0.00
R8113:Ncan UTSW 8 70108571 missense possibly damaging 0.58
R8947:Ncan UTSW 8 70102521 missense probably damaging 0.98
R9324:Ncan UTSW 8 70107998 missense possibly damaging 0.75
R9717:Ncan UTSW 8 70101978 missense probably damaging 1.00
R9803:Ncan UTSW 8 70108101 missense probably benign 0.06
Z1177:Ncan UTSW 8 70097472 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCAGCCACAACATTCAGGTCTG -3'
(R):5'- GGAACCTACAGTGGCTTTGGAG -3'

Sequencing Primer
(F):5'- AGGTCTGATTCATCCAAGCC -3'
(R):5'- CTTTGGAGGGAGGTGCCAC -3'
Posted On 2020-07-28