Incidental Mutation 'R8269:Ncan'
ID 639497
Institutional Source Beutler Lab
Gene Symbol Ncan
Ensembl Gene ENSMUSG00000002341
Gene Name neurocan
Synonyms Cspg3-rs, Tgfbit, Cspg3
MMRRC Submission 067693-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8269 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 70545735-70573494 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 70560330 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 879 (Q879L)
Ref Sequence ENSEMBL: ENSMUSP00000002412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002412]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000002412
AA Change: Q879L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: Q879L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 30 N/A INTRINSIC
IG 43 157 9.63e-6 SMART
LINK 157 254 2.22e-56 SMART
LINK 258 356 4.72e-60 SMART
low complexity region 575 586 N/A INTRINSIC
low complexity region 602 632 N/A INTRINSIC
low complexity region 663 677 N/A INTRINSIC
EGF 963 996 6.5e-5 SMART
EGF_CA 998 1034 9.77e-9 SMART
CLECT 1040 1161 1.97e-41 SMART
CCP 1167 1223 2.53e-12 SMART
low complexity region 1225 1256 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T C 14: 8,246,325 (GRCm38) T489A probably benign Het
Adgra3 A T 5: 50,121,079 (GRCm39) C850S probably damaging Het
Ago3 T A 4: 126,270,721 (GRCm39) K258* probably null Het
Akap11 G A 14: 78,750,818 (GRCm39) T523I Het
Amigo2 G T 15: 97,144,112 (GRCm39) N103K possibly damaging Het
Arfgap3 A C 15: 83,194,542 (GRCm39) S377A probably benign Het
Arhgap39 G T 15: 76,635,942 (GRCm39) Q98K probably benign Het
Atp1a4 T C 1: 172,059,892 (GRCm39) D779G probably damaging Het
Bckdhb T C 9: 84,004,417 (GRCm39) I388T probably benign Het
Ccpg1 G A 9: 72,913,001 (GRCm39) R179H probably damaging Het
Cd109 A G 9: 78,572,964 (GRCm39) K496R probably benign Het
Cnot1 A G 8: 96,478,389 (GRCm39) F979L probably damaging Het
Cyb5r1 T A 1: 134,334,803 (GRCm39) probably benign Het
D130040H23Rik T A 8: 69,755,800 (GRCm39) S402T probably benign Het
Dmtf1 A T 5: 9,182,500 (GRCm39) Y211* probably null Het
Dnah6 A G 6: 73,145,810 (GRCm39) probably null Het
Emc10 G T 7: 44,141,408 (GRCm39) Q227K possibly damaging Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Exosc4 A T 15: 76,211,732 (GRCm39) I14L probably benign Het
Fat2 T C 11: 55,173,535 (GRCm39) T2393A possibly damaging Het
Flg2 A T 3: 93,109,187 (GRCm39) H405L possibly damaging Het
Gin1 T A 1: 97,710,929 (GRCm39) M204K probably damaging Het
Gm57858 A T 3: 36,100,862 (GRCm39) N103K possibly damaging Het
Gnal A G 18: 67,268,693 (GRCm39) D193G possibly damaging Het
Itpr3 G T 17: 27,312,258 (GRCm39) R554L possibly damaging Het
Lipc A G 9: 70,727,655 (GRCm39) L149P probably damaging Het
Lrrc37a A G 11: 103,388,724 (GRCm39) Y2234H unknown Het
Lsm14b T C 2: 179,674,407 (GRCm39) S317P probably damaging Het
Mapk4 G C 18: 74,063,622 (GRCm39) F533L probably damaging Het
Mgll T A 6: 88,790,930 (GRCm39) Y183* probably null Het
Mrrf T A 2: 36,037,973 (GRCm39) D81E possibly damaging Het
Nox4 T G 7: 86,955,930 (GRCm39) probably benign Het
Or4p18 A T 2: 88,232,381 (GRCm39) V299D probably damaging Het
Or5p67 A T 7: 107,922,776 (GRCm39) C36S probably benign Het
Pcdhb10 A G 18: 37,547,062 (GRCm39) K713E probably benign Het
Phkb A G 8: 86,756,211 (GRCm39) D835G probably benign Het
Pld1 A G 3: 28,079,388 (GRCm39) N63D probably benign Het
Pls1 G T 9: 95,644,023 (GRCm39) T491K probably damaging Het
Plscr1 A G 9: 92,145,095 (GRCm39) D35G unknown Het
Slc28a2b C T 2: 122,352,169 (GRCm39) H336Y probably damaging Het
Slc3a1 A G 17: 85,339,982 (GRCm39) K180R probably benign Het
Suv39h1 G T X: 7,937,270 (GRCm39) Q129K probably benign Het
Tbc1d8 A G 1: 39,465,169 (GRCm39) V73A probably benign Het
Tmem161a T A 8: 70,634,608 (GRCm39) V421E probably benign Het
Topbp1 C A 9: 103,205,792 (GRCm39) P810Q possibly damaging Het
Ttc28 G A 5: 111,425,325 (GRCm39) V1717M probably benign Het
Vmn2r55 T A 7: 12,404,585 (GRCm39) T273S possibly damaging Het
Vwa5b2 A G 16: 20,423,188 (GRCm39) D1062G probably damaging Het
Zcrb1 A G 15: 93,295,056 (GRCm39) Y27H probably benign Het
Zfp128 G A 7: 12,624,663 (GRCm39) G344R probably damaging Het
Other mutations in Ncan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ncan APN 8 70,567,921 (GRCm39) missense probably benign 0.24
IGL00924:Ncan APN 8 70,561,039 (GRCm39) missense possibly damaging 0.78
IGL01319:Ncan APN 8 70,550,212 (GRCm39) missense probably damaging 0.99
IGL01407:Ncan APN 8 70,554,607 (GRCm39) missense probably benign 0.17
IGL01528:Ncan APN 8 70,562,731 (GRCm39) missense probably benign 0.00
IGL01567:Ncan APN 8 70,560,984 (GRCm39) missense probably benign 0.09
IGL01808:Ncan APN 8 70,560,090 (GRCm39) critical splice donor site probably null
IGL02543:Ncan APN 8 70,561,221 (GRCm39) missense probably benign 0.37
IGL02551:Ncan APN 8 70,555,112 (GRCm39) missense probably damaging 1.00
IGL02899:Ncan APN 8 70,567,698 (GRCm39) missense possibly damaging 0.95
IGL02940:Ncan APN 8 70,562,735 (GRCm39) missense probably benign 0.02
IGL03058:Ncan APN 8 70,560,582 (GRCm39) missense possibly damaging 0.83
learned UTSW 8 70,550,731 (GRCm39) nonsense probably null
sagacious UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R0219:Ncan UTSW 8 70,567,984 (GRCm39) missense probably benign 0.08
R0538:Ncan UTSW 8 70,561,252 (GRCm39) missense possibly damaging 0.86
R0540:Ncan UTSW 8 70,567,809 (GRCm39) missense possibly damaging 0.93
R0854:Ncan UTSW 8 70,565,202 (GRCm39) missense probably damaging 1.00
R0918:Ncan UTSW 8 70,561,039 (GRCm39) missense possibly damaging 0.78
R1344:Ncan UTSW 8 70,560,819 (GRCm39) missense probably benign
R1575:Ncan UTSW 8 70,562,848 (GRCm39) missense probably benign 0.27
R1739:Ncan UTSW 8 70,560,736 (GRCm39) missense probably benign 0.03
R1847:Ncan UTSW 8 70,555,104 (GRCm39) missense probably damaging 0.96
R1859:Ncan UTSW 8 70,567,998 (GRCm39) missense possibly damaging 0.94
R2320:Ncan UTSW 8 70,560,868 (GRCm39) missense probably benign
R2370:Ncan UTSW 8 70,565,463 (GRCm39) missense probably benign 0.05
R3407:Ncan UTSW 8 70,564,801 (GRCm39) missense probably damaging 1.00
R3408:Ncan UTSW 8 70,564,801 (GRCm39) missense probably damaging 1.00
R3961:Ncan UTSW 8 70,562,950 (GRCm39) missense probably benign 0.05
R4155:Ncan UTSW 8 70,562,727 (GRCm39) missense possibly damaging 0.87
R4156:Ncan UTSW 8 70,562,727 (GRCm39) missense possibly damaging 0.87
R4365:Ncan UTSW 8 70,567,861 (GRCm39) missense probably damaging 1.00
R4858:Ncan UTSW 8 70,556,705 (GRCm39) missense probably benign 0.00
R4925:Ncan UTSW 8 70,562,604 (GRCm39) missense probably benign 0.02
R4942:Ncan UTSW 8 70,552,944 (GRCm39) missense probably damaging 1.00
R4976:Ncan UTSW 8 70,567,675 (GRCm39) missense probably damaging 0.98
R5119:Ncan UTSW 8 70,567,675 (GRCm39) missense probably damaging 0.98
R5141:Ncan UTSW 8 70,565,487 (GRCm39) missense probably damaging 1.00
R5679:Ncan UTSW 8 70,565,276 (GRCm39) missense probably damaging 1.00
R5706:Ncan UTSW 8 70,554,667 (GRCm39) missense probably damaging 0.99
R5915:Ncan UTSW 8 70,550,731 (GRCm39) nonsense probably null
R6033:Ncan UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R6033:Ncan UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R6223:Ncan UTSW 8 70,562,604 (GRCm39) missense probably benign 0.02
R6390:Ncan UTSW 8 70,567,899 (GRCm39) missense probably benign 0.34
R6533:Ncan UTSW 8 70,549,007 (GRCm39) missense probably benign 0.01
R6836:Ncan UTSW 8 70,552,965 (GRCm39) missense possibly damaging 0.84
R6869:Ncan UTSW 8 70,560,557 (GRCm39) missense probably benign 0.08
R7229:Ncan UTSW 8 70,552,961 (GRCm39) missense possibly damaging 0.69
R7232:Ncan UTSW 8 70,564,738 (GRCm39) missense probably damaging 1.00
R7293:Ncan UTSW 8 70,567,861 (GRCm39) missense probably damaging 0.98
R7406:Ncan UTSW 8 70,562,749 (GRCm39) missense probably benign 0.00
R7474:Ncan UTSW 8 70,554,691 (GRCm39) missense possibly damaging 0.53
R7779:Ncan UTSW 8 70,567,661 (GRCm39) missense probably damaging 0.99
R7973:Ncan UTSW 8 70,550,225 (GRCm39) missense probably benign 0.00
R8113:Ncan UTSW 8 70,561,221 (GRCm39) missense possibly damaging 0.58
R8947:Ncan UTSW 8 70,555,171 (GRCm39) missense probably damaging 0.98
R9324:Ncan UTSW 8 70,560,648 (GRCm39) missense possibly damaging 0.75
R9717:Ncan UTSW 8 70,554,628 (GRCm39) missense probably damaging 1.00
R9803:Ncan UTSW 8 70,560,751 (GRCm39) missense probably benign 0.06
Z1177:Ncan UTSW 8 70,550,122 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCAGCCACAACATTCAGGTCTG -3'
(R):5'- GGAACCTACAGTGGCTTTGGAG -3'

Sequencing Primer
(F):5'- AGGTCTGATTCATCCAAGCC -3'
(R):5'- CTTTGGAGGGAGGTGCCAC -3'
Posted On 2020-07-28