Incidental Mutation 'R8269:Cnot1'
ID 639500
Institutional Source Beutler Lab
Gene Symbol Cnot1
Ensembl Gene ENSMUSG00000036550
Gene Name CCR4-NOT transcription complex, subunit 1
Synonyms 6030411K04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8269 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 95719451-95807464 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 95751761 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 979 (F979L)
Ref Sequence ENSEMBL: ENSMUSP00000063565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006] [ENSMUST00000213046]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000068452
AA Change: F979L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: F979L

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098473
AA Change: F984L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: F984L

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211887
AA Change: F977L

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000213006
AA Change: F984L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000213046
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T C 14: 8,246,325 T489A probably benign Het
Adgra3 A T 5: 49,963,737 C850S probably damaging Het
Ago3 T A 4: 126,376,928 K258* probably null Het
Akap11 G A 14: 78,513,378 T523I Het
Amigo2 G T 15: 97,246,231 N103K possibly damaging Het
Arfgap3 A C 15: 83,310,341 S377A probably benign Het
Arhgap39 G T 15: 76,751,742 Q98K probably benign Het
Atp1a4 T C 1: 172,232,325 D779G probably damaging Het
Bckdhb T C 9: 84,122,364 I388T probably benign Het
Ccdc144b A T 3: 36,046,713 N103K possibly damaging Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Cd109 A G 9: 78,665,682 K496R probably benign Het
Cyb5r1 T A 1: 134,407,065 probably benign Het
D130040H23Rik T A 8: 69,303,148 S402T probably benign Het
Dmtf1 A T 5: 9,132,500 Y211* probably null Het
Dnah6 A G 6: 73,168,827 probably null Het
Emc10 G T 7: 44,491,984 Q227K possibly damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Exosc4 A T 15: 76,327,532 I14L probably benign Het
Fat2 T C 11: 55,282,709 T2393A possibly damaging Het
Flg2 A T 3: 93,201,880 H405L possibly damaging Het
Gin1 T A 1: 97,783,204 M204K probably damaging Het
Gm14085 C T 2: 122,521,688 H336Y probably damaging Het
Gnal A G 18: 67,135,622 D193G possibly damaging Het
Itpr3 G T 17: 27,093,284 R554L possibly damaging Het
Lipc A G 9: 70,820,373 L149P probably damaging Het
Lrrc37a A G 11: 103,497,898 Y2234H unknown Het
Lsm14b T C 2: 180,032,614 S317P probably damaging Het
Mapk4 G C 18: 73,930,551 F533L probably damaging Het
Mgll T A 6: 88,813,948 Y183* probably null Het
Mrrf T A 2: 36,147,961 D81E possibly damaging Het
Ncan T A 8: 70,107,680 Q879L probably benign Het
Nox4 T G 7: 87,306,722 probably benign Het
Olfr1179 A T 2: 88,402,037 V299D probably damaging Het
Olfr492 A T 7: 108,323,569 C36S probably benign Het
Pcdhb10 A G 18: 37,414,009 K713E probably benign Het
Phkb A G 8: 86,029,582 D835G probably benign Het
Pld1 A G 3: 28,025,239 N63D probably benign Het
Pls1 G T 9: 95,761,970 T491K probably damaging Het
Plscr1 A G 9: 92,263,042 D35G unknown Het
Slc3a1 A G 17: 85,032,554 K180R probably benign Het
Suv39h1 G T X: 8,071,031 Q129K probably benign Het
Tbc1d8 A G 1: 39,426,088 V73A probably benign Het
Tmem161a T A 8: 70,181,958 V421E probably benign Het
Topbp1 C A 9: 103,328,593 P810Q possibly damaging Het
Ttc28 G A 5: 111,277,459 V1717M probably benign Het
Vmn2r55 T A 7: 12,670,658 T273S possibly damaging Het
Vwa5b2 A G 16: 20,604,438 D1062G probably damaging Het
Zcrb1 A G 15: 93,397,175 Y27H probably benign Het
Zfp128 G A 7: 12,890,736 G344R probably damaging Het
Other mutations in Cnot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cnot1 APN 8 95726079 missense probably damaging 1.00
IGL01340:Cnot1 APN 8 95760537 missense probably damaging 1.00
IGL01457:Cnot1 APN 8 95741009 missense probably damaging 1.00
IGL01505:Cnot1 APN 8 95728718 missense probably damaging 0.98
IGL02401:Cnot1 APN 8 95756133 missense possibly damaging 0.95
IGL02693:Cnot1 APN 8 95773485 missense probably damaging 1.00
IGL02696:Cnot1 APN 8 95745017 missense probably benign 0.00
IGL02754:Cnot1 APN 8 95755078 missense probably benign 0.03
IGL03092:Cnot1 APN 8 95769615 intron probably benign
IGL03174:Cnot1 APN 8 95761355 missense probably damaging 1.00
IGL03310:Cnot1 APN 8 95735680 splice site probably benign
IGL03371:Cnot1 APN 8 95774716 missense possibly damaging 0.85
Affiliate UTSW 8 95765125 missense probably damaging 0.99
Barge UTSW 8 95734129 missense probably benign 0.13
Byproduct UTSW 8 95745647 frame shift probably null
Chairman UTSW 8 95765027 missense possibly damaging 0.95
cohort UTSW 8 95735749 missense probably damaging 0.99
Director UTSW 8 95765062 missense probably benign 0.15
kowloon UTSW 8 95788658 missense probably damaging 1.00
tugboat UTSW 8 95773618 missense probably damaging 0.99
Xiao UTSW 8 95730420 missense probably damaging 1.00
BB001:Cnot1 UTSW 8 95745647 frame shift probably null
BB003:Cnot1 UTSW 8 95745647 frame shift probably null
BB011:Cnot1 UTSW 8 95745647 frame shift probably null
BB013:Cnot1 UTSW 8 95745647 frame shift probably null
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0091:Cnot1 UTSW 8 95763144 missense probably damaging 1.00
R0335:Cnot1 UTSW 8 95772000 missense probably benign 0.02
R0409:Cnot1 UTSW 8 95748855 missense probably damaging 0.96
R0445:Cnot1 UTSW 8 95760208 missense probably damaging 1.00
R1505:Cnot1 UTSW 8 95728667 missense probably damaging 1.00
R1517:Cnot1 UTSW 8 95743213 missense probably benign 0.38
R1640:Cnot1 UTSW 8 95769832 missense probably damaging 0.98
R1737:Cnot1 UTSW 8 95748276 missense probably damaging 0.98
R1755:Cnot1 UTSW 8 95724577 missense probably damaging 1.00
R1901:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1902:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1903:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1988:Cnot1 UTSW 8 95741944 missense possibly damaging 0.89
R2051:Cnot1 UTSW 8 95724593 missense possibly damaging 0.47
R2054:Cnot1 UTSW 8 95739841 missense possibly damaging 0.55
R2072:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2074:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2075:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2093:Cnot1 UTSW 8 95775358 missense probably damaging 1.00
R2116:Cnot1 UTSW 8 95726153 missense probably damaging 1.00
R2191:Cnot1 UTSW 8 95761426 missense probably damaging 0.98
R2238:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2239:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2251:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2252:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2253:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2315:Cnot1 UTSW 8 95749062 missense probably damaging 1.00
R2431:Cnot1 UTSW 8 95774652 missense probably damaging 1.00
R2988:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R2989:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3108:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3109:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3114:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3115:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3153:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3154:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R4112:Cnot1 UTSW 8 95773618 missense probably damaging 0.99
R4359:Cnot1 UTSW 8 95739848 missense probably damaging 1.00
R4382:Cnot1 UTSW 8 95769779 missense probably damaging 0.97
R4747:Cnot1 UTSW 8 95774682 missense probably benign 0.27
R4910:Cnot1 UTSW 8 95733231 missense probably benign 0.43
R4913:Cnot1 UTSW 8 95763067 missense possibly damaging 0.63
R4971:Cnot1 UTSW 8 95721626 missense probably damaging 1.00
R5056:Cnot1 UTSW 8 95741008 missense probably damaging 1.00
R5092:Cnot1 UTSW 8 95752768 missense possibly damaging 0.91
R5101:Cnot1 UTSW 8 95760187 missense possibly damaging 0.90
R5498:Cnot1 UTSW 8 95757355 missense possibly damaging 0.92
R5719:Cnot1 UTSW 8 95744296 missense possibly damaging 0.92
R5850:Cnot1 UTSW 8 95734147 nonsense probably null
R5956:Cnot1 UTSW 8 95754978 critical splice donor site probably null
R5981:Cnot1 UTSW 8 95788665 missense probably damaging 1.00
R6093:Cnot1 UTSW 8 95748894 missense probably benign 0.03
R6108:Cnot1 UTSW 8 95730420 missense probably damaging 1.00
R6261:Cnot1 UTSW 8 95741921 missense probably benign 0.00
R6632:Cnot1 UTSW 8 95773267 intron probably benign
R6882:Cnot1 UTSW 8 95720426 missense possibly damaging 0.85
R6966:Cnot1 UTSW 8 95724532 missense probably damaging 1.00
R6985:Cnot1 UTSW 8 95734129 missense probably benign 0.13
R7210:Cnot1 UTSW 8 95788658 missense probably damaging 1.00
R7410:Cnot1 UTSW 8 95733159 missense possibly damaging 0.77
R7623:Cnot1 UTSW 8 95727648 missense probably damaging 1.00
R7624:Cnot1 UTSW 8 95751819 missense probably damaging 1.00
R7695:Cnot1 UTSW 8 95770632 missense probably benign 0.03
R7703:Cnot1 UTSW 8 95760098 critical splice donor site probably null
R7771:Cnot1 UTSW 8 95765125 missense probably damaging 0.99
R7800:Cnot1 UTSW 8 95765062 missense probably benign 0.15
R7809:Cnot1 UTSW 8 95751778 missense probably damaging 1.00
R7857:Cnot1 UTSW 8 95745647 frame shift probably null
R7914:Cnot1 UTSW 8 95745647 frame shift probably null
R7924:Cnot1 UTSW 8 95745647 frame shift probably null
R7926:Cnot1 UTSW 8 95745647 frame shift probably null
R7981:Cnot1 UTSW 8 95763169 missense probably damaging 1.00
R8004:Cnot1 UTSW 8 95752752 missense probably benign 0.03
R8061:Cnot1 UTSW 8 95765027 missense possibly damaging 0.95
R8185:Cnot1 UTSW 8 95761351 missense probably damaging 1.00
R8306:Cnot1 UTSW 8 95747021 missense probably benign 0.05
R8322:Cnot1 UTSW 8 95769844 missense probably benign 0.00
R8427:Cnot1 UTSW 8 95734324 missense probably benign 0.01
R8723:Cnot1 UTSW 8 95736279 missense probably benign 0.00
R8934:Cnot1 UTSW 8 95765067 missense probably benign 0.04
R9025:Cnot1 UTSW 8 95749032 missense probably benign
R9280:Cnot1 UTSW 8 95770599 missense probably benign 0.15
R9285:Cnot1 UTSW 8 95726118 missense probably damaging 1.00
R9299:Cnot1 UTSW 8 95741820 missense probably damaging 1.00
R9337:Cnot1 UTSW 8 95741820 missense probably damaging 1.00
X0050:Cnot1 UTSW 8 95743098 splice site probably null
Z1176:Cnot1 UTSW 8 95748277 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CACAAAGTGTACTCTGACCTCCG -3'
(R):5'- GGCTGGTAGTCTTCCATTTGAC -3'

Sequencing Primer
(F):5'- AAGTGTACTCTGACCTCCGTACAG -3'
(R):5'- CCATTTGACATTCTCTTCAAAGTAAC -3'
Posted On 2020-07-28