Incidental Mutation 'R8269:Lipc'
ID639501
Institutional Source Beutler Lab
Gene Symbol Lipc
Ensembl Gene ENSMUSG00000032207
Gene Namelipase, hepatic
SynonymsHpl, HL
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R8269 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location70798128-70952226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70820373 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 149 (L149P)
Ref Sequence ENSEMBL: ENSMUSP00000034731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034731]
Predicted Effect probably damaging
Transcript: ENSMUST00000034731
AA Change: L149P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034731
Gene: ENSMUSG00000032207
AA Change: L149P

DomainStartEndE-ValueType
Pfam:Lipase 14 350 1.1e-136 PFAM
LH2 353 488 4.62e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LIPC encodes hepatic triglyceride lipase, which is expressed in liver. LIPC has the dual functions of triglyceride hydrolase and ligand/bridging factor for receptor-mediated lipoprotein uptake. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit elevated plasma total cholesterol, phospholipids, and high density lipoprotein cholesterol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T C 14: 8,246,325 T489A probably benign Het
Adgra3 A T 5: 49,963,737 C850S probably damaging Het
Ago3 T A 4: 126,376,928 K258* probably null Het
Akap11 G A 14: 78,513,378 T523I Het
Amigo2 G T 15: 97,246,231 N103K possibly damaging Het
Arfgap3 A C 15: 83,310,341 S377A probably benign Het
Arhgap39 G T 15: 76,751,742 Q98K probably benign Het
Atp1a4 T C 1: 172,232,325 D779G probably damaging Het
Bckdhb T C 9: 84,122,364 I388T probably benign Het
Ccdc144b A T 3: 36,046,713 N103K possibly damaging Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Cd109 A G 9: 78,665,682 K496R probably benign Het
Cnot1 A G 8: 95,751,761 F979L probably damaging Het
D130040H23Rik T A 8: 69,303,148 S402T probably benign Het
Dmtf1 A T 5: 9,132,500 Y211* probably null Het
Dnah6 A G 6: 73,168,827 probably null Het
Emc10 G T 7: 44,491,984 Q227K possibly damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Exosc4 A T 15: 76,327,532 I14L probably benign Het
Fat2 T C 11: 55,282,709 T2393A possibly damaging Het
Flg2 A T 3: 93,201,880 H405L possibly damaging Het
Gin1 T A 1: 97,783,204 M204K probably damaging Het
Gm14085 C T 2: 122,521,688 H336Y probably damaging Het
Gnal A G 18: 67,135,622 D193G possibly damaging Het
Itpr3 G T 17: 27,093,284 R554L possibly damaging Het
Lrrc37a A G 11: 103,497,898 Y2234H unknown Het
Lsm14b T C 2: 180,032,614 S317P probably damaging Het
Mapk4 G C 18: 73,930,551 F533L probably damaging Het
Mgll T A 6: 88,813,948 Y183* probably null Het
Mrrf T A 2: 36,147,961 D81E possibly damaging Het
Ncan T A 8: 70,107,680 Q879L probably benign Het
Olfr1179 A T 2: 88,402,037 V299D probably damaging Het
Olfr492 A T 7: 108,323,569 C36S probably benign Het
Pcdhb10 A G 18: 37,414,009 K713E probably benign Het
Phkb A G 8: 86,029,582 D835G probably benign Het
Pld1 A G 3: 28,025,239 N63D probably benign Het
Pls1 G T 9: 95,761,970 T491K probably damaging Het
Plscr1 A G 9: 92,263,042 D35G unknown Het
Slc3a1 A G 17: 85,032,554 K180R probably benign Het
Suv39h1 G T X: 8,071,031 Q129K probably benign Het
Tbc1d8 A G 1: 39,426,088 V73A probably benign Het
Tmem161a T A 8: 70,181,958 V421E probably benign Het
Topbp1 C A 9: 103,328,593 P810Q possibly damaging Het
Ttc28 G A 5: 111,277,459 V1717M probably benign Het
Vmn2r55 T A 7: 12,670,658 T273S possibly damaging Het
Vwa5b2 A G 16: 20,604,438 D1062G probably damaging Het
Zcrb1 A G 15: 93,397,175 Y27H probably benign Het
Zfp128 G A 7: 12,890,736 G344R probably damaging Het
Other mutations in Lipc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Lipc APN 9 70820437 missense possibly damaging 0.56
IGL02431:Lipc APN 9 70934468 intron probably benign
Immunobolic UTSW 9 70823386 missense probably damaging 1.00
R0112:Lipc UTSW 9 70820427 missense probably damaging 1.00
R0114:Lipc UTSW 9 70803781 missense probably damaging 0.99
R0545:Lipc UTSW 9 70812705 missense probably damaging 1.00
R1051:Lipc UTSW 9 70802116 missense probably benign 0.00
R1069:Lipc UTSW 9 70823537 missense probably benign 0.03
R1350:Lipc UTSW 9 70798367 missense probably benign 0.00
R1742:Lipc UTSW 9 70820529 missense probably damaging 1.00
R2145:Lipc UTSW 9 70934535 missense possibly damaging 0.94
R3880:Lipc UTSW 9 70820518 missense probably damaging 0.99
R4360:Lipc UTSW 9 70852582 intron probably benign
R4999:Lipc UTSW 9 70816731 missense probably benign 0.00
R5159:Lipc UTSW 9 70812910 missense probably benign 0.03
R5197:Lipc UTSW 9 70798391 missense probably benign 0.11
R5458:Lipc UTSW 9 70852582 intron probably benign
R5710:Lipc UTSW 9 70812697 missense probably benign 0.30
R6645:Lipc UTSW 9 70803748 missense probably damaging 1.00
R6749:Lipc UTSW 9 70823386 missense probably damaging 1.00
R6849:Lipc UTSW 9 70818847 critical splice donor site probably null
R7011:Lipc UTSW 9 70818954 missense probably benign 0.09
R7346:Lipc UTSW 9 70812747 missense probably damaging 1.00
R7426:Lipc UTSW 9 70802168 missense probably benign 0.21
R7587:Lipc UTSW 9 70818924 missense probably damaging 1.00
R7830:Lipc UTSW 9 70812901 missense probably damaging 1.00
X0054:Lipc UTSW 9 70812748 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGAAGTAACTGGACACTGCTG -3'
(R):5'- CCCTCTGCCCTTGTAGTAAG -3'

Sequencing Primer
(F):5'- TAACTGGACACTGCTGCTCCAG -3'
(R):5'- CTGTGGCCCACCCTCAG -3'
Posted On2020-07-28