Incidental Mutation 'R8269:Bckdhb'
ID639504
Institutional Source Beutler Lab
Gene Symbol Bckdhb
Ensembl Gene ENSMUSG00000032263
Gene Namebranched chain ketoacid dehydrogenase E1, beta polypeptide
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8269 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location83925145-84124240 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84122364 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 388 (I388T)
Ref Sequence ENSEMBL: ENSMUSP00000139684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034801] [ENSMUST00000190166] [ENSMUST00000190637]
Predicted Effect probably benign
Transcript: ENSMUST00000034801
AA Change: I320T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000034801
Gene: ENSMUSG00000032263
AA Change: I320T

DomainStartEndE-ValueType
Transket_pyr 1 176 4.92e-60 SMART
Pfam:Transketolase_C 191 312 1.5e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190166
AA Change: I320T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000140598
Gene: ENSMUSG00000032263
AA Change: I320T

DomainStartEndE-ValueType
Transket_pyr 1 176 4.92e-60 SMART
Pfam:Transketolase_C 191 309 3.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190637
AA Change: I388T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000139684
Gene: ENSMUSG00000032263
AA Change: I388T

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Transket_pyr 69 244 4.92e-60 SMART
Pfam:Transketolase_C 259 377 1.1e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the beta chain of the branched chain alpha ketoacid dehydrogenase (Bckdh) complex. The encoded protein exists in a heterotetrameric complex containing the Bckdh alpha subunit to form the E1 catalytic component of Bckdh complex. The Bckdh complex catalyzes the oxidative decarboxylation of branched chain ketoacids to their corresponding acyl-CoA esters, during the catabolism of leucine, isoleucine and valine. In humans, certain mutations in this gene cause maple syrup urine disease. Alternative splicing results in multiple transcript variants encoding different isoforms. A pseudogene for this gene has been identified. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T C 14: 8,246,325 T489A probably benign Het
Adgra3 A T 5: 49,963,737 C850S probably damaging Het
Ago3 T A 4: 126,376,928 K258* probably null Het
Akap11 G A 14: 78,513,378 T523I Het
Amigo2 G T 15: 97,246,231 N103K possibly damaging Het
Arfgap3 A C 15: 83,310,341 S377A probably benign Het
Arhgap39 G T 15: 76,751,742 Q98K probably benign Het
Atp1a4 T C 1: 172,232,325 D779G probably damaging Het
Ccdc144b A T 3: 36,046,713 N103K possibly damaging Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Cd109 A G 9: 78,665,682 K496R probably benign Het
Cnot1 A G 8: 95,751,761 F979L probably damaging Het
D130040H23Rik T A 8: 69,303,148 S402T probably benign Het
Dmtf1 A T 5: 9,132,500 Y211* probably null Het
Dnah6 A G 6: 73,168,827 probably null Het
Emc10 G T 7: 44,491,984 Q227K possibly damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Exosc4 A T 15: 76,327,532 I14L probably benign Het
Fat2 T C 11: 55,282,709 T2393A possibly damaging Het
Flg2 A T 3: 93,201,880 H405L possibly damaging Het
Gin1 T A 1: 97,783,204 M204K probably damaging Het
Gm14085 C T 2: 122,521,688 H336Y probably damaging Het
Gnal A G 18: 67,135,622 D193G possibly damaging Het
Itpr3 G T 17: 27,093,284 R554L possibly damaging Het
Lipc A G 9: 70,820,373 L149P probably damaging Het
Lrrc37a A G 11: 103,497,898 Y2234H unknown Het
Lsm14b T C 2: 180,032,614 S317P probably damaging Het
Mapk4 G C 18: 73,930,551 F533L probably damaging Het
Mgll T A 6: 88,813,948 Y183* probably null Het
Mrrf T A 2: 36,147,961 D81E possibly damaging Het
Ncan T A 8: 70,107,680 Q879L probably benign Het
Olfr1179 A T 2: 88,402,037 V299D probably damaging Het
Olfr492 A T 7: 108,323,569 C36S probably benign Het
Pcdhb10 A G 18: 37,414,009 K713E probably benign Het
Phkb A G 8: 86,029,582 D835G probably benign Het
Pld1 A G 3: 28,025,239 N63D probably benign Het
Pls1 G T 9: 95,761,970 T491K probably damaging Het
Plscr1 A G 9: 92,263,042 D35G unknown Het
Slc3a1 A G 17: 85,032,554 K180R probably benign Het
Suv39h1 G T X: 8,071,031 Q129K probably benign Het
Tbc1d8 A G 1: 39,426,088 V73A probably benign Het
Tmem161a T A 8: 70,181,958 V421E probably benign Het
Topbp1 C A 9: 103,328,593 P810Q possibly damaging Het
Ttc28 G A 5: 111,277,459 V1717M probably benign Het
Vmn2r55 T A 7: 12,670,658 T273S possibly damaging Het
Vwa5b2 A G 16: 20,604,438 D1062G probably damaging Het
Zcrb1 A G 15: 93,397,175 Y27H probably benign Het
Zfp128 G A 7: 12,890,736 G344R probably damaging Het
Other mutations in Bckdhb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01973:Bckdhb APN 9 83991736 missense probably benign
IGL02537:Bckdhb APN 9 83989141 missense probably benign 0.07
IGL02808:Bckdhb APN 9 83988845 missense probably benign 0.05
R0608:Bckdhb UTSW 9 83953736 missense probably damaging 1.00
R1780:Bckdhb UTSW 9 83953783 critical splice donor site probably null
R3892:Bckdhb UTSW 9 83988810 missense probably damaging 1.00
R4825:Bckdhb UTSW 9 83988905 missense probably damaging 1.00
R6018:Bckdhb UTSW 9 84069184 missense probably benign 0.41
R6823:Bckdhb UTSW 9 83953761 missense possibly damaging 0.76
R7350:Bckdhb UTSW 9 84010326 missense possibly damaging 0.93
R7383:Bckdhb UTSW 9 83953713 missense possibly damaging 0.66
R7759:Bckdhb UTSW 9 84010326 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CACCCAGACACTTTGATATCCATAG -3'
(R):5'- GCTGGCAGAAGTTTGAGCAG -3'

Sequencing Primer
(F):5'- TTTGATATCCATAGATGTATTGTGGC -3'
(R):5'- CAGAAGTTTGAGCAGTTTCATGAAG -3'
Posted On2020-07-28