Incidental Mutation 'R8268:Olfr1121'
ID639526
Institutional Source Beutler Lab
Gene Symbol Olfr1121
Ensembl Gene ENSMUSG00000070852
Gene Nameolfactory receptor 1121
SynonymsMOR264-18, GA_x6K02T2Q125-48863863-48864807
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R8268 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87369895-87373469 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 87371988 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 152 (A152E)
Ref Sequence ENSEMBL: ENSMUSP00000058201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062555]
Predicted Effect probably damaging
Transcript: ENSMUST00000062555
AA Change: A152E

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058201
Gene: ENSMUSG00000070852
AA Change: A152E

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 3.3e-54 PFAM
Pfam:7tm_1 47 296 3.2e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,457,317 C396S probably benign Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Ciapin1 A G 8: 94,831,883 V67A probably benign Het
Col7a1 A G 9: 108,972,989 R2018G unknown Het
Dnah11 A T 12: 118,027,508 Y2374* probably null Het
Dnah7b G T 1: 46,356,576 M3879I probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Gm12258 A C 11: 58,854,258 probably null Het
Hpse A G 5: 100,699,041 L174S probably damaging Het
Hspa8 A G 9: 40,803,152 K248R probably damaging Het
Kcnt2 A C 1: 140,523,216 R744S probably damaging Het
Klhl32 G A 4: 24,800,843 probably benign Het
Mkrn3 A G 7: 62,418,522 L507P probably damaging Het
Myom2 T G 8: 15,129,157 F1330V probably damaging Het
Nr1d2 A G 14: 18,216,659 S170P probably damaging Het
Nt5dc1 T C 10: 34,310,411 D388G probably damaging Het
Olfr1240 T C 2: 89,439,436 N281S probably damaging Het
Olfr1352 T A 10: 78,983,997 V69E probably damaging Het
Olfr45 A G 7: 140,691,517 D204G probably damaging Het
Pigg T A 5: 108,338,643 S721T probably damaging Het
Prr5 T C 15: 84,702,991 L323P probably benign Het
Rapgef2 T A 3: 79,085,956 I742L probably benign Het
Rxrb A G 17: 34,035,776 S302G probably benign Het
Setd5 T G 6: 113,149,690 probably null Het
Sh3bgr A G 16: 96,224,474 T187A unknown Het
Sh3pxd2a C T 19: 47,267,594 R923H probably benign Het
Slc26a10 A G 10: 127,173,622 probably null Het
Slc9a1 T A 4: 133,370,623 V27E probably benign Het
Stard3nl A G 13: 19,376,459 S49P probably damaging Het
Stxbp2 G A 8: 3,632,234 V17I Het
Themis3 C T 17: 66,555,791 E391K probably benign Het
Tia1 A G 6: 86,428,014 probably benign Het
Tmem167 T C 13: 90,104,435 F70S probably damaging Het
Trpm6 C A 19: 18,873,861 Q1729K possibly damaging Het
Tsc2 A C 17: 24,600,010 L1285W probably benign Het
Uchl4 A T 9: 64,235,509 I91F probably damaging Het
Wdfy3 C T 5: 101,941,610 A573T probably damaging Het
Zc2hc1c C T 12: 85,289,821 S84F probably benign Het
Zfp143 A G 7: 110,091,784 D515G probably benign Het
Other mutations in Olfr1121
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02534:Olfr1121 APN 2 87372254 missense probably benign
IGL03280:Olfr1121 APN 2 87372123 missense probably damaging 1.00
R0501:Olfr1121 UTSW 2 87371552 missense probably damaging 0.96
R1350:Olfr1121 UTSW 2 87372357 missense probably benign
R1713:Olfr1121 UTSW 2 87371946 missense probably damaging 1.00
R2404:Olfr1121 UTSW 2 87372224 missense probably benign 0.09
R4737:Olfr1121 UTSW 2 87372321 missense probably damaging 0.99
R4825:Olfr1121 UTSW 2 87372088 nonsense probably null
R5109:Olfr1121 UTSW 2 87371534 start codon destroyed probably null 0.04
R5200:Olfr1121 UTSW 2 87372102 missense probably damaging 0.99
R6393:Olfr1121 UTSW 2 87371565 missense probably damaging 1.00
R6658:Olfr1121 UTSW 2 87372153 missense probably benign 0.01
R7011:Olfr1121 UTSW 2 87372260 missense possibly damaging 0.74
R7427:Olfr1121 UTSW 2 87371690 missense probably benign 0.01
R7428:Olfr1121 UTSW 2 87371690 missense probably benign 0.01
R7671:Olfr1121 UTSW 2 87372269 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATCAGTCATTCTCCCTAGGGTTC -3'
(R):5'- GCAAGCAGGATAGCCACTAC -3'

Sequencing Primer
(F):5'- GTTCTGTACAGCATTTGGACCCAAG -3'
(R):5'- GCAGGATAGCCACTACATAGAC -3'
Posted On2020-07-28