Incidental Mutation 'R8268:Rapgef2'
ID639528
Institutional Source Beutler Lab
Gene Symbol Rapgef2
Ensembl Gene ENSMUSG00000062232
Gene NameRap guanine nucleotide exchange factor (GEF) 2
SynonymsCNRasGEF, RA-GEF-1, Pdzgef1, nRapGEP, 5830453M24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8268 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location79062516-79286517 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79085956 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 742 (I742L)
Ref Sequence ENSEMBL: ENSMUSP00000114119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118100] [ENSMUST00000118340] [ENSMUST00000195708]
Predicted Effect probably benign
Transcript: ENSMUST00000118100
AA Change: I742L

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000114119
Gene: ENSMUSG00000062232
AA Change: I742L

DomainStartEndE-ValueType
low complexity region 38 62 N/A INTRINSIC
low complexity region 84 95 N/A INTRINSIC
cNMP 135 253 2.48e-15 SMART
RasGEFN 267 380 1.3e-31 SMART
PDZ 395 467 1.28e-12 SMART
RA 606 692 7.59e-23 SMART
RasGEF 713 950 6.09e-100 SMART
low complexity region 1030 1046 N/A INTRINSIC
low complexity region 1110 1124 N/A INTRINSIC
low complexity region 1140 1161 N/A INTRINSIC
low complexity region 1392 1405 N/A INTRINSIC
low complexity region 1440 1455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118340
AA Change: I740L

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113778
Gene: ENSMUSG00000062232
AA Change: I740L

DomainStartEndE-ValueType
low complexity region 36 60 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
cNMP 133 251 2.48e-15 SMART
RasGEFN 265 378 1.3e-31 SMART
PDZ 393 465 1.28e-12 SMART
RA 604 690 7.59e-23 SMART
RasGEF 711 948 6.09e-100 SMART
low complexity region 1028 1044 N/A INTRINSIC
low complexity region 1108 1122 N/A INTRINSIC
low complexity region 1138 1159 N/A INTRINSIC
low complexity region 1390 1403 N/A INTRINSIC
low complexity region 1438 1453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195708
AA Change: I890L

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141542
Gene: ENSMUSG00000062232
AA Change: I890L

DomainStartEndE-ValueType
cNMP 24 131 3.9e-4 SMART
low complexity region 186 210 N/A INTRINSIC
low complexity region 232 243 N/A INTRINSIC
cNMP 283 401 1.2e-17 SMART
RasGEFN 415 528 6.4e-34 SMART
PDZ 543 615 6.4e-15 SMART
RA 754 840 4.8e-25 SMART
RasGEF 861 1098 3.8e-102 SMART
low complexity region 1178 1194 N/A INTRINSIC
low complexity region 1258 1272 N/A INTRINSIC
low complexity region 1288 1309 N/A INTRINSIC
low complexity region 1540 1553 N/A INTRINSIC
low complexity region 1588 1603 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RAPGEF2, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a null allele die at mid-gestation exhibiting growth arrest and defects in vascular development, neural tube closure and embryo turning. Homozygotes for another null allele show yolk sac vascular defects, impaired cell physiology and heart, primitive gut, liver and brain formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,457,317 C396S probably benign Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Ciapin1 A G 8: 94,831,883 V67A probably benign Het
Col7a1 A G 9: 108,972,989 R2018G unknown Het
Dnah11 A T 12: 118,027,508 Y2374* probably null Het
Dnah7b G T 1: 46,356,576 M3879I probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Gm12258 A C 11: 58,854,258 probably null Het
Hpse A G 5: 100,699,041 L174S probably damaging Het
Hspa8 A G 9: 40,803,152 K248R probably damaging Het
Kcnt2 A C 1: 140,523,216 R744S probably damaging Het
Klhl32 G A 4: 24,800,843 probably benign Het
Mkrn3 A G 7: 62,418,522 L507P probably damaging Het
Myom2 T G 8: 15,129,157 F1330V probably damaging Het
Nr1d2 A G 14: 18,216,659 S170P probably damaging Het
Nt5dc1 T C 10: 34,310,411 D388G probably damaging Het
Olfr1121 C A 2: 87,371,988 A152E probably damaging Het
Olfr1240 T C 2: 89,439,436 N281S probably damaging Het
Olfr1352 T A 10: 78,983,997 V69E probably damaging Het
Olfr45 A G 7: 140,691,517 D204G probably damaging Het
Pigg T A 5: 108,338,643 S721T probably damaging Het
Prr5 T C 15: 84,702,991 L323P probably benign Het
Rxrb A G 17: 34,035,776 S302G probably benign Het
Setd5 T G 6: 113,149,690 probably null Het
Sh3bgr A G 16: 96,224,474 T187A unknown Het
Sh3pxd2a C T 19: 47,267,594 R923H probably benign Het
Slc26a10 A G 10: 127,173,622 probably null Het
Slc9a1 T A 4: 133,370,623 V27E probably benign Het
Stard3nl A G 13: 19,376,459 S49P probably damaging Het
Stxbp2 G A 8: 3,632,234 V17I Het
Themis3 C T 17: 66,555,791 E391K probably benign Het
Tia1 A G 6: 86,428,014 probably benign Het
Tmem167 T C 13: 90,104,435 F70S probably damaging Het
Trpm6 C A 19: 18,873,861 Q1729K possibly damaging Het
Tsc2 A C 17: 24,600,010 L1285W probably benign Het
Uchl4 A T 9: 64,235,509 I91F probably damaging Het
Wdfy3 C T 5: 101,941,610 A573T probably damaging Het
Zc2hc1c C T 12: 85,289,821 S84F probably benign Het
Zfp143 A G 7: 110,091,784 D515G probably benign Het
Other mutations in Rapgef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Rapgef2 APN 3 79092025 missense possibly damaging 0.89
IGL01024:Rapgef2 APN 3 79070138 missense probably benign 0.43
IGL01448:Rapgef2 APN 3 79068937 missense probably benign
IGL01448:Rapgef2 APN 3 79103962 critical splice donor site probably null
IGL01928:Rapgef2 APN 3 79103963 missense probably damaging 1.00
IGL01973:Rapgef2 APN 3 79091809 splice site probably null
IGL02015:Rapgef2 APN 3 79092064 splice site probably benign
IGL02498:Rapgef2 APN 3 79066753 missense probably damaging 0.97
IGL02631:Rapgef2 APN 3 79083226 missense possibly damaging 0.77
IGL02835:Rapgef2 APN 3 79092986 splice site probably benign
IGL02887:Rapgef2 APN 3 79068880 splice site probably benign
IGL03030:Rapgef2 APN 3 79074307 critical splice donor site probably null
IGL03035:Rapgef2 APN 3 79094424 missense probably damaging 1.00
IGL03222:Rapgef2 APN 3 79087995 missense probably damaging 1.00
IGL03227:Rapgef2 APN 3 79092613 splice site probably benign
IGL03326:Rapgef2 APN 3 79091833 missense probably damaging 0.96
IGL03335:Rapgef2 APN 3 79099185 missense probably damaging 1.00
IGL03384:Rapgef2 APN 3 79083546 missense probably damaging 1.00
Bulge UTSW 3 79079132 missense probably benign 0.01
Hai_phat UTSW 3 79085959 missense probably damaging 1.00
R0022:Rapgef2 UTSW 3 79087900 missense probably damaging 1.00
R0022:Rapgef2 UTSW 3 79087900 missense probably damaging 1.00
R0038:Rapgef2 UTSW 3 79069396 missense probably benign 0.00
R0117:Rapgef2 UTSW 3 79079177 missense probably benign 0.00
R0225:Rapgef2 UTSW 3 79104105 missense probably damaging 0.99
R0723:Rapgef2 UTSW 3 79079174 missense probably benign 0.20
R0788:Rapgef2 UTSW 3 79099195 missense possibly damaging 0.59
R1311:Rapgef2 UTSW 3 79083547 missense probably benign 0.12
R1374:Rapgef2 UTSW 3 79087968 missense probably benign 0.08
R1507:Rapgef2 UTSW 3 79081293 splice site probably benign
R1523:Rapgef2 UTSW 3 79092749 missense probably damaging 1.00
R1753:Rapgef2 UTSW 3 79088791 missense possibly damaging 0.65
R1759:Rapgef2 UTSW 3 79066731 missense possibly damaging 0.89
R1766:Rapgef2 UTSW 3 79092703 missense probably damaging 1.00
R2436:Rapgef2 UTSW 3 79088772 missense possibly damaging 0.95
R3033:Rapgef2 UTSW 3 79074306 critical splice donor site probably null
R3766:Rapgef2 UTSW 3 79088750 missense probably benign 0.01
R4118:Rapgef2 UTSW 3 79068887 critical splice donor site probably null
R4416:Rapgef2 UTSW 3 79069057 nonsense probably null
R4722:Rapgef2 UTSW 3 79069173 missense probably benign 0.00
R4743:Rapgef2 UTSW 3 79173068 missense probably damaging 0.99
R4780:Rapgef2 UTSW 3 79169769 splice site probably benign
R4825:Rapgef2 UTSW 3 79083227 missense probably benign 0.03
R4861:Rapgef2 UTSW 3 79074436 missense probably benign 0.01
R4861:Rapgef2 UTSW 3 79074436 missense probably benign 0.01
R4900:Rapgef2 UTSW 3 79074363 missense probably benign 0.02
R4943:Rapgef2 UTSW 3 79064547 missense probably benign 0.00
R5291:Rapgef2 UTSW 3 79070059 missense possibly damaging 0.64
R5369:Rapgef2 UTSW 3 79069432 missense probably benign 0.00
R5413:Rapgef2 UTSW 3 79087866 missense probably damaging 1.00
R5561:Rapgef2 UTSW 3 79088643 critical splice donor site probably null
R5568:Rapgef2 UTSW 3 79104001 missense probably damaging 1.00
R5642:Rapgef2 UTSW 3 79094850 missense probably damaging 1.00
R5783:Rapgef2 UTSW 3 79087993 missense probably benign 0.00
R6041:Rapgef2 UTSW 3 79069162 missense probably benign 0.00
R6193:Rapgef2 UTSW 3 79069444 missense possibly damaging 0.48
R6324:Rapgef2 UTSW 3 79079132 missense probably benign 0.01
R6551:Rapgef2 UTSW 3 79215035 splice site probably null
R6688:Rapgef2 UTSW 3 79069128 missense probably benign 0.03
R6908:Rapgef2 UTSW 3 79104063 missense probably benign 0.01
R6913:Rapgef2 UTSW 3 79085974 missense probably damaging 1.00
R6933:Rapgef2 UTSW 3 79085959 missense probably damaging 1.00
R7086:Rapgef2 UTSW 3 79086046 missense probably benign 0.08
R7106:Rapgef2 UTSW 3 79066608 missense probably benign
R7228:Rapgef2 UTSW 3 79069218 missense probably benign 0.03
R7242:Rapgef2 UTSW 3 79087903 nonsense probably null
R7257:Rapgef2 UTSW 3 79082627 missense probably damaging 0.99
R7322:Rapgef2 UTSW 3 79145823 start codon destroyed probably null 0.02
R7443:Rapgef2 UTSW 3 79081224 missense probably damaging 1.00
R7450:Rapgef2 UTSW 3 79173059 missense probably benign 0.01
R7472:Rapgef2 UTSW 3 79069273 missense probably benign 0.45
R7884:Rapgef2 UTSW 3 79066626 missense possibly damaging 0.49
R7954:Rapgef2 UTSW 3 79070147 nonsense probably null
R7957:Rapgef2 UTSW 3 79214969 missense probably benign 0.27
R8071:Rapgef2 UTSW 3 79093036 missense probably damaging 1.00
R8261:Rapgef2 UTSW 3 79086018 missense probably benign 0.34
R8309:Rapgef2 UTSW 3 79083202 missense possibly damaging 0.65
R8505:Rapgef2 UTSW 3 79079042 nonsense probably null
R8783:Rapgef2 UTSW 3 79098344 missense probably damaging 1.00
R8897:Rapgef2 UTSW 3 79112259 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCTGATGATTGCAAACATGGAG -3'
(R):5'- TCAGCTTGGCATCTGAAGAGC -3'

Sequencing Primer
(F):5'- GGAGTTAAAATTCTTGCATTCCCTG -3'
(R):5'- CTTGGCATCTGAAGAGCTTCTG -3'
Posted On2020-07-28