Incidental Mutation 'R0691:Gucy1b1'
ID63953
Institutional Source Beutler Lab
Gene Symbol Gucy1b1
Ensembl Gene ENSMUSG00000028005
Gene Nameguanylate cyclase 1, soluble, beta 1
Synonymsbeta 1 sGC
MMRRC Submission 038876-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R0691 (G1)
Quality Score102
Status Validated
Chromosome3
Chromosomal Location82032006-82074689 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 82045634 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029635] [ENSMUST00000193597]
Predicted Effect probably benign
Transcript: ENSMUST00000029635
SMART Domains Protein: ENSMUSP00000029635
Gene: ENSMUSG00000028005

DomainStartEndE-ValueType
Pfam:HNOB 2 166 3.4e-58 PFAM
low complexity region 182 189 N/A INTRINSIC
PDB:4GJ4|D 212 343 9e-16 PDB
CYCc 385 586 3.53e-93 SMART
low complexity region 608 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193597
SMART Domains Protein: ENSMUSP00000142119
Gene: ENSMUSG00000028005

DomainStartEndE-ValueType
Pfam:HNOB 1 172 1.5e-67 PFAM
low complexity region 182 189 N/A INTRINSIC
PDB:4GJ4|D 212 343 9e-16 PDB
CYCc 385 582 1.71e-91 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of the soluble guanylate cyclase (sGC), which catalyzes the conversion of GTP (guanosine triphosphate) to cGMP (cyclic guanosine monophosphate). The encoded protein contains an HNOX domain, which serves as a receptor for ligands such as nitric oxide, oxygen and nitrovasodilator drugs. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice that bypass neonatal lethality die prematurely due to severe gastrointestinal obstruction and exhibit hypertension, reduced heart rate, lack of glycerol trinitrate-induced drop in systolic pressure, and lack of a nitric oxide effect on aortic relaxation and platelet aggregation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,639,253 D865G possibly damaging Het
Acy1 A T 9: 106,435,871 probably null Het
Adcy4 A T 14: 55,772,647 probably benign Het
Anpep T G 7: 79,839,299 D347A probably damaging Het
Arhgap28 C T 17: 67,896,164 probably null Het
Ccdc32 A G 2: 119,027,129 probably benign Het
Cdc42bpa A G 1: 180,144,835 T1401A possibly damaging Het
Celsr2 A G 3: 108,412,623 Y958H probably damaging Het
Cenpe A G 3: 135,217,305 E137G probably damaging Het
Chd8 T C 14: 52,213,433 D1399G probably damaging Het
Cntn3 T C 6: 102,168,947 T978A possibly damaging Het
Col10a1 A G 10: 34,395,696 T555A possibly damaging Het
Crybg3 A C 16: 59,565,211 probably null Het
Cts7 A G 13: 61,355,734 F139L probably damaging Het
Dera T C 6: 137,796,747 probably benign Het
Dgka A G 10: 128,723,260 probably benign Het
Dhrs7 T A 12: 72,652,351 I286F probably damaging Het
Dtwd2 A G 18: 49,728,357 probably benign Het
Fam160b2 T C 14: 70,588,287 D351G probably damaging Het
Fermt1 A G 2: 132,906,733 S657P probably damaging Het
Flnb T C 14: 7,890,810 V564A probably benign Het
Garnl3 A G 2: 33,085,907 F16L probably damaging Het
Gck T C 11: 5,906,691 R191G probably damaging Het
Ifna2 A C 4: 88,683,658 L41R probably damaging Het
Krt33a T G 11: 100,012,715 E197A probably damaging Het
Lce1e G A 3: 92,707,756 R95C unknown Het
Lct G T 1: 128,308,234 S345R probably benign Het
Lrp2 A T 2: 69,451,380 N3882K probably benign Het
Mcc G T 18: 44,445,860 T652K possibly damaging Het
Mier1 A G 4: 103,139,502 S109G probably benign Het
Nfat5 A G 8: 107,355,605 N469S probably damaging Het
Olfr382 C A 11: 73,516,844 M118I possibly damaging Het
Olfr807 G A 10: 129,755,402 T16I probably damaging Het
Piwil1 G T 5: 128,743,307 R256M probably null Het
Rgma T C 7: 73,409,412 V88A probably damaging Het
Sdk2 T C 11: 113,794,920 probably null Het
Sec22b A G 3: 97,912,674 E94G probably damaging Het
Snrnp70 T C 7: 45,387,245 R131G possibly damaging Het
Spata31d1a A G 13: 59,700,385 S1310P possibly damaging Het
Spint1 A G 2: 119,246,467 E344G probably damaging Het
Srrm1 G A 4: 135,324,991 Q141* probably null Het
Tecta A T 9: 42,384,341 L286Q probably damaging Het
Tep1 T A 14: 50,866,844 K198* probably null Het
Tk2 A G 8: 104,231,192 V174A probably benign Het
Txndc5 T C 13: 38,507,896 K165E probably damaging Het
Ubr4 G A 4: 139,423,906 R1884Q probably damaging Het
Vmn2r61 T C 7: 42,300,420 Y755H probably damaging Het
Xrn1 T A 9: 95,973,539 H296Q probably damaging Het
Zar1l A T 5: 150,512,942 V223D probably damaging Het
Other mutations in Gucy1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Gucy1b1 APN 3 82034862 missense probably damaging 1.00
IGL01602:Gucy1b1 APN 3 82035353 missense probably benign 0.17
IGL01603:Gucy1b1 APN 3 82034868 missense probably damaging 0.98
IGL01605:Gucy1b1 APN 3 82035353 missense probably benign 0.17
IGL01685:Gucy1b1 APN 3 82035285 missense probably benign 0.27
IGL01844:Gucy1b1 APN 3 82046526 missense possibly damaging 0.95
IGL02566:Gucy1b1 APN 3 82058329 missense probably damaging 1.00
R0014:Gucy1b1 UTSW 3 82039861 missense probably damaging 1.00
R0068:Gucy1b1 UTSW 3 82034878 missense probably benign 0.34
R0115:Gucy1b1 UTSW 3 82034391 missense probably benign
R0126:Gucy1b1 UTSW 3 82037911 splice site probably benign
R0277:Gucy1b1 UTSW 3 82038156 critical splice acceptor site probably null
R0323:Gucy1b1 UTSW 3 82038156 critical splice acceptor site probably null
R0633:Gucy1b1 UTSW 3 82045460 missense probably benign 0.02
R0811:Gucy1b1 UTSW 3 82037988 missense probably benign 0.04
R0812:Gucy1b1 UTSW 3 82037988 missense probably benign 0.04
R1670:Gucy1b1 UTSW 3 82045460 missense probably benign 0.10
R1687:Gucy1b1 UTSW 3 82038042 missense probably damaging 1.00
R1856:Gucy1b1 UTSW 3 82058352 missense probably benign 0.00
R1950:Gucy1b1 UTSW 3 82045409 missense probably benign 0.43
R1995:Gucy1b1 UTSW 3 82034853 missense probably damaging 1.00
R2156:Gucy1b1 UTSW 3 82061020 missense probably benign
R2441:Gucy1b1 UTSW 3 82045454 missense probably damaging 0.98
R5014:Gucy1b1 UTSW 3 82046667 missense probably benign 0.43
R5397:Gucy1b1 UTSW 3 82044151 missense possibly damaging 0.92
R5494:Gucy1b1 UTSW 3 82039876 missense probably damaging 1.00
R6003:Gucy1b1 UTSW 3 82058277 missense probably damaging 1.00
R6088:Gucy1b1 UTSW 3 82034880 missense probably damaging 1.00
R6216:Gucy1b1 UTSW 3 82046713 splice site probably null
R6331:Gucy1b1 UTSW 3 82034411 missense possibly damaging 0.75
R6671:Gucy1b1 UTSW 3 82034408 missense probably benign
R6753:Gucy1b1 UTSW 3 82039747 missense probably null 0.03
R7150:Gucy1b1 UTSW 3 82043162 missense probably damaging 1.00
R7228:Gucy1b1 UTSW 3 82033274 missense unknown
R7461:Gucy1b1 UTSW 3 82039747 missense possibly damaging 0.74
R7501:Gucy1b1 UTSW 3 82035359 missense probably damaging 1.00
R7613:Gucy1b1 UTSW 3 82039747 missense possibly damaging 0.74
R7791:Gucy1b1 UTSW 3 82035397 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACACTGAGTGACCACTAGGTTCCG -3'
(R):5'- AGCCAAGCCAGCTCAGGTCTTTTC -3'

Sequencing Primer
(F):5'- CCACTAGGTTCCGGTCAAATATG -3'
(R):5'- TGTACAAACATCCCTGTTCAGGAG -3'
Posted On2013-07-30