Incidental Mutation 'R0691:Gucy1b1'
ID 63953
Institutional Source Beutler Lab
Gene Symbol Gucy1b1
Ensembl Gene ENSMUSG00000028005
Gene Name guanylate cyclase 1, soluble, beta 1
Synonyms beta 1 sGC, Gucy1b3
MMRRC Submission 038876-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.900) question?
Stock # R0691 (G1)
Quality Score 102
Status Validated
Chromosome 3
Chromosomal Location 81939313-81981996 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 81952941 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029635] [ENSMUST00000193597]
AlphaFold O54865
Predicted Effect probably benign
Transcript: ENSMUST00000029635
SMART Domains Protein: ENSMUSP00000029635
Gene: ENSMUSG00000028005

DomainStartEndE-ValueType
Pfam:HNOB 2 166 3.4e-58 PFAM
low complexity region 182 189 N/A INTRINSIC
PDB:4GJ4|D 212 343 9e-16 PDB
CYCc 385 586 3.53e-93 SMART
low complexity region 608 620 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193597
SMART Domains Protein: ENSMUSP00000142119
Gene: ENSMUSG00000028005

DomainStartEndE-ValueType
Pfam:HNOB 1 172 1.5e-67 PFAM
low complexity region 182 189 N/A INTRINSIC
PDB:4GJ4|D 212 343 9e-16 PDB
CYCc 385 582 1.71e-91 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of the soluble guanylate cyclase (sGC), which catalyzes the conversion of GTP (guanosine triphosphate) to cGMP (cyclic guanosine monophosphate). The encoded protein contains an HNOX domain, which serves as a receptor for ligands such as nitric oxide, oxygen and nitrovasodilator drugs. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice that bypass neonatal lethality die prematurely due to severe gastrointestinal obstruction and exhibit hypertension, reduced heart rate, lack of glycerol trinitrate-induced drop in systolic pressure, and lack of a nitric oxide effect on aortic relaxation and platelet aggregation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,584,979 (GRCm39) D865G possibly damaging Het
Acy1 A T 9: 106,313,070 (GRCm39) probably null Het
Adcy4 A T 14: 56,010,104 (GRCm39) probably benign Het
Anpep T G 7: 79,489,047 (GRCm39) D347A probably damaging Het
Arhgap28 C T 17: 68,203,159 (GRCm39) probably null Het
Ccdc32 A G 2: 118,857,610 (GRCm39) probably benign Het
Cdc42bpa A G 1: 179,972,400 (GRCm39) T1401A possibly damaging Het
Celsr2 A G 3: 108,319,939 (GRCm39) Y958H probably damaging Het
Cenpe A G 3: 134,923,066 (GRCm39) E137G probably damaging Het
Chd8 T C 14: 52,450,890 (GRCm39) D1399G probably damaging Het
Cntn3 T C 6: 102,145,908 (GRCm39) T978A possibly damaging Het
Col10a1 A G 10: 34,271,692 (GRCm39) T555A possibly damaging Het
Crybg3 A C 16: 59,385,574 (GRCm39) probably null Het
Cts7 A G 13: 61,503,548 (GRCm39) F139L probably damaging Het
Dera T C 6: 137,773,745 (GRCm39) probably benign Het
Dgka A G 10: 128,559,129 (GRCm39) probably benign Het
Dhrs7 T A 12: 72,699,125 (GRCm39) I286F probably damaging Het
Dtwd2 A G 18: 49,861,424 (GRCm39) probably benign Het
Fermt1 A G 2: 132,748,653 (GRCm39) S657P probably damaging Het
Fhip2b T C 14: 70,825,727 (GRCm39) D351G probably damaging Het
Flnb T C 14: 7,890,810 (GRCm38) V564A probably benign Het
Garnl3 A G 2: 32,975,919 (GRCm39) F16L probably damaging Het
Gck T C 11: 5,856,691 (GRCm39) R191G probably damaging Het
Ifna2 A C 4: 88,601,895 (GRCm39) L41R probably damaging Het
Krt33a T G 11: 99,903,541 (GRCm39) E197A probably damaging Het
Lce1e G A 3: 92,615,063 (GRCm39) R95C unknown Het
Lct G T 1: 128,235,971 (GRCm39) S345R probably benign Het
Lrp2 A T 2: 69,281,724 (GRCm39) N3882K probably benign Het
Mcc G T 18: 44,578,927 (GRCm39) T652K possibly damaging Het
Mier1 A G 4: 102,996,699 (GRCm39) S109G probably benign Het
Nfat5 A G 8: 108,082,237 (GRCm39) N469S probably damaging Het
Or1e23 C A 11: 73,407,670 (GRCm39) M118I possibly damaging Het
Or6c214 G A 10: 129,591,271 (GRCm39) T16I probably damaging Het
Piwil1 G T 5: 128,820,371 (GRCm39) R256M probably null Het
Rgma T C 7: 73,059,160 (GRCm39) V88A probably damaging Het
Sdk2 T C 11: 113,685,746 (GRCm39) probably null Het
Sec22b A G 3: 97,819,990 (GRCm39) E94G probably damaging Het
Snrnp70 T C 7: 45,036,669 (GRCm39) R131G possibly damaging Het
Spata31d1a A G 13: 59,848,199 (GRCm39) S1310P possibly damaging Het
Spint1 A G 2: 119,076,948 (GRCm39) E344G probably damaging Het
Srrm1 G A 4: 135,052,302 (GRCm39) Q141* probably null Het
Tecta A T 9: 42,295,637 (GRCm39) L286Q probably damaging Het
Tep1 T A 14: 51,104,301 (GRCm39) K198* probably null Het
Tk2 A G 8: 104,957,824 (GRCm39) V174A probably benign Het
Txndc5 T C 13: 38,691,872 (GRCm39) K165E probably damaging Het
Ubr4 G A 4: 139,151,217 (GRCm39) R1884Q probably damaging Het
Vmn2r61 T C 7: 41,949,844 (GRCm39) Y755H probably damaging Het
Xrn1 T A 9: 95,855,592 (GRCm39) H296Q probably damaging Het
Zar1l A T 5: 150,436,407 (GRCm39) V223D probably damaging Het
Other mutations in Gucy1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Gucy1b1 APN 3 81,942,169 (GRCm39) missense probably damaging 1.00
IGL01602:Gucy1b1 APN 3 81,942,660 (GRCm39) missense probably benign 0.17
IGL01603:Gucy1b1 APN 3 81,942,175 (GRCm39) missense probably damaging 0.98
IGL01605:Gucy1b1 APN 3 81,942,660 (GRCm39) missense probably benign 0.17
IGL01685:Gucy1b1 APN 3 81,942,592 (GRCm39) missense probably benign 0.27
IGL01844:Gucy1b1 APN 3 81,953,833 (GRCm39) missense possibly damaging 0.95
IGL02566:Gucy1b1 APN 3 81,965,636 (GRCm39) missense probably damaging 1.00
R0014:Gucy1b1 UTSW 3 81,947,168 (GRCm39) missense probably damaging 1.00
R0068:Gucy1b1 UTSW 3 81,942,185 (GRCm39) missense probably benign 0.34
R0115:Gucy1b1 UTSW 3 81,941,698 (GRCm39) missense probably benign
R0126:Gucy1b1 UTSW 3 81,945,218 (GRCm39) splice site probably benign
R0277:Gucy1b1 UTSW 3 81,945,463 (GRCm39) critical splice acceptor site probably null
R0323:Gucy1b1 UTSW 3 81,945,463 (GRCm39) critical splice acceptor site probably null
R0633:Gucy1b1 UTSW 3 81,952,767 (GRCm39) missense probably benign 0.02
R0811:Gucy1b1 UTSW 3 81,945,295 (GRCm39) missense probably benign 0.04
R0812:Gucy1b1 UTSW 3 81,945,295 (GRCm39) missense probably benign 0.04
R1670:Gucy1b1 UTSW 3 81,952,767 (GRCm39) missense probably benign 0.10
R1687:Gucy1b1 UTSW 3 81,945,349 (GRCm39) missense probably damaging 1.00
R1856:Gucy1b1 UTSW 3 81,965,659 (GRCm39) missense probably benign 0.00
R1950:Gucy1b1 UTSW 3 81,952,716 (GRCm39) missense probably benign 0.43
R1995:Gucy1b1 UTSW 3 81,942,160 (GRCm39) missense probably damaging 1.00
R2156:Gucy1b1 UTSW 3 81,968,327 (GRCm39) missense probably benign
R2441:Gucy1b1 UTSW 3 81,952,761 (GRCm39) missense probably damaging 0.98
R5014:Gucy1b1 UTSW 3 81,953,974 (GRCm39) missense probably benign 0.43
R5397:Gucy1b1 UTSW 3 81,951,458 (GRCm39) missense possibly damaging 0.92
R5494:Gucy1b1 UTSW 3 81,947,183 (GRCm39) missense probably damaging 1.00
R6003:Gucy1b1 UTSW 3 81,965,584 (GRCm39) missense probably damaging 1.00
R6088:Gucy1b1 UTSW 3 81,942,187 (GRCm39) missense probably damaging 1.00
R6216:Gucy1b1 UTSW 3 81,954,020 (GRCm39) splice site probably null
R6331:Gucy1b1 UTSW 3 81,941,718 (GRCm39) missense possibly damaging 0.75
R6671:Gucy1b1 UTSW 3 81,941,715 (GRCm39) missense probably benign
R6753:Gucy1b1 UTSW 3 81,947,054 (GRCm39) missense probably null 0.03
R7150:Gucy1b1 UTSW 3 81,950,469 (GRCm39) missense probably damaging 1.00
R7228:Gucy1b1 UTSW 3 81,940,581 (GRCm39) missense unknown
R7461:Gucy1b1 UTSW 3 81,947,054 (GRCm39) missense possibly damaging 0.74
R7501:Gucy1b1 UTSW 3 81,942,666 (GRCm39) missense probably damaging 1.00
R7613:Gucy1b1 UTSW 3 81,947,054 (GRCm39) missense possibly damaging 0.74
R7791:Gucy1b1 UTSW 3 81,942,704 (GRCm39) nonsense probably null
R8560:Gucy1b1 UTSW 3 81,942,685 (GRCm39) missense probably damaging 0.98
R9312:Gucy1b1 UTSW 3 81,942,123 (GRCm39) missense probably damaging 1.00
R9553:Gucy1b1 UTSW 3 81,947,087 (GRCm39) missense probably damaging 1.00
R9559:Gucy1b1 UTSW 3 81,947,054 (GRCm39) missense possibly damaging 0.74
R9762:Gucy1b1 UTSW 3 81,942,065 (GRCm39) missense possibly damaging 0.76
Z1177:Gucy1b1 UTSW 3 81,968,419 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTGAGTGACCACTAGGTTCCG -3'
(R):5'- AGCCAAGCCAGCTCAGGTCTTTTC -3'

Sequencing Primer
(F):5'- CCACTAGGTTCCGGTCAAATATG -3'
(R):5'- TGTACAAACATCCCTGTTCAGGAG -3'
Posted On 2013-07-30