Incidental Mutation 'R8268:Slc9a1'
ID639530
Institutional Source Beutler Lab
Gene Symbol Slc9a1
Ensembl Gene ENSMUSG00000028854
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 1
SynonymsApnh, Nhe1, antiporter
MMRRC Submission
Accession Numbers

Genbank: NM_016981; MGI: 102462

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8268 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location133369706-133423702 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 133370623 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 27 (V27E)
Ref Sequence ENSEMBL: ENSMUSP00000030669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030669]
Predicted Effect probably benign
Transcript: ENSMUST00000030669
AA Change: V27E

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000030669
Gene: ENSMUSG00000028854
AA Change: V27E

DomainStartEndE-ValueType
transmembrane domain 15 33 N/A INTRINSIC
Pfam:Na_H_Exchanger 109 509 1.3e-89 PFAM
Pfam:NEXCaM_BD 603 704 1.5e-34 PFAM
low complexity region 757 764 N/A INTRINSIC
low complexity region 803 814 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Na+/H+ antiporter that is a member of the solute carrier family 9. The encoded protein is a plasma membrane transporter that is expressed in the kidney and intestine. This protein plays a central role in regulating pH homeostasis, cell migration and cell volume. This protein may also be involved in tumor growth. [provided by RefSeq, Sep 2011]
PHENOTYPE: Two-thirds of homozygous null mice die before weaning with reduced body weight, ataxia, a relatively mild stomach phenotype, and a postmortem appearance suggestive of death by a convulsive seizure. Homozygotes also display impaired fluid secretion and NaCl absorption in their parotid glands. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(6) Spontaneous(1)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,457,317 C396S probably benign Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Ciapin1 A G 8: 94,831,883 V67A probably benign Het
Col7a1 A G 9: 108,972,989 R2018G unknown Het
Dnah11 A T 12: 118,027,508 Y2374* probably null Het
Dnah7b G T 1: 46,356,576 M3879I probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Gm12258 A C 11: 58,854,258 probably null Het
Hpse A G 5: 100,699,041 L174S probably damaging Het
Hspa8 A G 9: 40,803,152 K248R probably damaging Het
Kcnt2 A C 1: 140,523,216 R744S probably damaging Het
Klhl32 G A 4: 24,800,843 probably benign Het
Mkrn3 A G 7: 62,418,522 L507P probably damaging Het
Myom2 T G 8: 15,129,157 F1330V probably damaging Het
Nr1d2 A G 14: 18,216,659 S170P probably damaging Het
Nt5dc1 T C 10: 34,310,411 D388G probably damaging Het
Olfr1121 C A 2: 87,371,988 A152E probably damaging Het
Olfr1240 T C 2: 89,439,436 N281S probably damaging Het
Olfr1352 T A 10: 78,983,997 V69E probably damaging Het
Olfr45 A G 7: 140,691,517 D204G probably damaging Het
Pigg T A 5: 108,338,643 S721T probably damaging Het
Prr5 T C 15: 84,702,991 L323P probably benign Het
Rapgef2 T A 3: 79,085,956 I742L probably benign Het
Rxrb A G 17: 34,035,776 S302G probably benign Het
Setd5 T G 6: 113,149,690 probably null Het
Sh3bgr A G 16: 96,224,474 T187A unknown Het
Sh3pxd2a C T 19: 47,267,594 R923H probably benign Het
Slc26a10 A G 10: 127,173,622 probably null Het
Stard3nl A G 13: 19,376,459 S49P probably damaging Het
Stxbp2 G A 8: 3,632,234 V17I Het
Themis3 C T 17: 66,555,791 E391K probably benign Het
Tia1 A G 6: 86,428,014 probably benign Het
Tmem167 T C 13: 90,104,435 F70S probably damaging Het
Trpm6 C A 19: 18,873,861 Q1729K possibly damaging Het
Tsc2 A C 17: 24,600,010 L1285W probably benign Het
Uchl4 A T 9: 64,235,509 I91F probably damaging Het
Wdfy3 C T 5: 101,941,610 A573T probably damaging Het
Zc2hc1c C T 12: 85,289,821 S84F probably benign Het
Zfp143 A G 7: 110,091,784 D515G probably benign Het
Other mutations in Slc9a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Slc9a1 APN 4 133370548 missense probably benign 0.03
IGL00949:Slc9a1 APN 4 133416451 missense probably benign 0.03
IGL00952:Slc9a1 APN 4 133416382 missense probably damaging 0.99
IGL01023:Slc9a1 APN 4 133422143 missense probably benign 0.04
IGL01151:Slc9a1 APN 4 133411989 missense probably damaging 1.00
IGL01796:Slc9a1 APN 4 133420093 splice site probably benign
IGL01896:Slc9a1 APN 4 133418059 missense probably damaging 1.00
IGL02621:Slc9a1 APN 4 133370568 missense probably benign
F6893:Slc9a1 UTSW 4 133422146 missense probably benign 0.06
R0123:Slc9a1 UTSW 4 133420605 missense probably benign 0.34
R0134:Slc9a1 UTSW 4 133420605 missense probably benign 0.34
R0225:Slc9a1 UTSW 4 133420605 missense probably benign 0.34
R0658:Slc9a1 UTSW 4 133420499 splice site probably benign
R0759:Slc9a1 UTSW 4 133416403 missense probably damaging 1.00
R0781:Slc9a1 UTSW 4 133370548 missense probably benign 0.03
R1110:Slc9a1 UTSW 4 133370548 missense probably benign 0.03
R1316:Slc9a1 UTSW 4 133422247 missense possibly damaging 0.95
R1637:Slc9a1 UTSW 4 133422223 missense probably benign
R1680:Slc9a1 UTSW 4 133418080 missense probably damaging 1.00
R2050:Slc9a1 UTSW 4 133416334 missense probably benign 0.02
R4279:Slc9a1 UTSW 4 133412089 missense probably benign 0.31
R4960:Slc9a1 UTSW 4 133370656 missense probably damaging 1.00
R5381:Slc9a1 UTSW 4 133422071 missense probably damaging 0.96
R5590:Slc9a1 UTSW 4 133421563 missense probably damaging 0.99
R5638:Slc9a1 UTSW 4 133412260 missense probably damaging 1.00
R5935:Slc9a1 UTSW 4 133419865 intron probably benign
R6334:Slc9a1 UTSW 4 133422208 missense possibly damaging 0.64
R6402:Slc9a1 UTSW 4 133370651 missense probably benign 0.37
R7553:Slc9a1 UTSW 4 133412269 missense probably damaging 1.00
R7772:Slc9a1 UTSW 4 133411965 missense probably damaging 1.00
R7843:Slc9a1 UTSW 4 133370442 start gained probably benign
R8359:Slc9a1 UTSW 4 133420616 missense probably damaging 1.00
R8398:Slc9a1 UTSW 4 133419503 missense probably benign 0.05
X0018:Slc9a1 UTSW 4 133418071 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGAGATTGCCCCAGTCTCAC -3'
(R):5'- AGGGTAGTCAATGTCCAGGAC -3'

Sequencing Primer
(F):5'- AGTCTCACCCCATCTGCAGG -3'
(R):5'- GCTTACCGCCATGTTCAATGATTAAG -3'
Posted On2020-07-28