Incidental Mutation 'R8268:Uchl4'
ID639544
Institutional Source Beutler Lab
Gene Symbol Uchl4
Ensembl Gene ENSMUSG00000035337
Gene Nameubiquitin carboxyl-terminal esterase L4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8268 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location64235201-64236362 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64235509 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 91 (I91F)
Ref Sequence ENSEMBL: ENSMUSP00000045208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005066] [ENSMUST00000039011]
Predicted Effect probably benign
Transcript: ENSMUST00000005066
SMART Domains Protein: ENSMUSP00000005066
Gene: ENSMUSG00000004936

DomainStartEndE-ValueType
low complexity region 30 51 N/A INTRINSIC
S_TKc 68 361 4.44e-80 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000039011
AA Change: I91F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045208
Gene: ENSMUSG00000035337
AA Change: I91F

DomainStartEndE-ValueType
Pfam:Peptidase_C12 6 217 2.2e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,457,317 C396S probably benign Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Ciapin1 A G 8: 94,831,883 V67A probably benign Het
Col7a1 A G 9: 108,972,989 R2018G unknown Het
Dnah11 A T 12: 118,027,508 Y2374* probably null Het
Dnah7b G T 1: 46,356,576 M3879I probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Gm12258 A C 11: 58,854,258 probably null Het
Hpse A G 5: 100,699,041 L174S probably damaging Het
Hspa8 A G 9: 40,803,152 K248R probably damaging Het
Kcnt2 A C 1: 140,523,216 R744S probably damaging Het
Klhl32 G A 4: 24,800,843 probably benign Het
Mkrn3 A G 7: 62,418,522 L507P probably damaging Het
Myom2 T G 8: 15,129,157 F1330V probably damaging Het
Nr1d2 A G 14: 18,216,659 S170P probably damaging Het
Nt5dc1 T C 10: 34,310,411 D388G probably damaging Het
Olfr1121 C A 2: 87,371,988 A152E probably damaging Het
Olfr1240 T C 2: 89,439,436 N281S probably damaging Het
Olfr1352 T A 10: 78,983,997 V69E probably damaging Het
Olfr45 A G 7: 140,691,517 D204G probably damaging Het
Pigg T A 5: 108,338,643 S721T probably damaging Het
Prr5 T C 15: 84,702,991 L323P probably benign Het
Rapgef2 T A 3: 79,085,956 I742L probably benign Het
Rxrb A G 17: 34,035,776 S302G probably benign Het
Setd5 T G 6: 113,149,690 probably null Het
Sh3bgr A G 16: 96,224,474 T187A unknown Het
Sh3pxd2a C T 19: 47,267,594 R923H probably benign Het
Slc26a10 A G 10: 127,173,622 probably null Het
Slc9a1 T A 4: 133,370,623 V27E probably benign Het
Stard3nl A G 13: 19,376,459 S49P probably damaging Het
Stxbp2 G A 8: 3,632,234 V17I Het
Themis3 C T 17: 66,555,791 E391K probably benign Het
Tia1 A G 6: 86,428,014 probably benign Het
Tmem167 T C 13: 90,104,435 F70S probably damaging Het
Trpm6 C A 19: 18,873,861 Q1729K possibly damaging Het
Tsc2 A C 17: 24,600,010 L1285W probably benign Het
Wdfy3 C T 5: 101,941,610 A573T probably damaging Het
Zc2hc1c C T 12: 85,289,821 S84F probably benign Het
Zfp143 A G 7: 110,091,784 D515G probably benign Het
Other mutations in Uchl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Uchl4 APN 9 64235716 missense possibly damaging 0.82
IGL01710:Uchl4 APN 9 64235506 missense probably benign 0.20
IGL02030:Uchl4 APN 9 64235629 missense probably benign
IGL02739:Uchl4 APN 9 64235537 missense probably damaging 1.00
R0026:Uchl4 UTSW 9 64235371 splice site probably null
R0026:Uchl4 UTSW 9 64235371 splice site probably null
R1572:Uchl4 UTSW 9 64235731 missense probably benign
R1801:Uchl4 UTSW 9 64235475 missense probably benign
R2113:Uchl4 UTSW 9 64235536 missense probably damaging 1.00
R4042:Uchl4 UTSW 9 64235557 missense probably benign 0.00
R4500:Uchl4 UTSW 9 64235881 missense possibly damaging 0.96
R4625:Uchl4 UTSW 9 64235798 missense probably damaging 1.00
R5176:Uchl4 UTSW 9 64235740 nonsense probably null
R5364:Uchl4 UTSW 9 64235539 missense possibly damaging 0.88
R6581:Uchl4 UTSW 9 64235793 missense possibly damaging 0.93
R7134:Uchl4 UTSW 9 64235339 missense probably damaging 1.00
R7451:Uchl4 UTSW 9 64235731 missense probably benign
R8804:Uchl4 UTSW 9 64235324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTAGGCCTGCATCCTAACTGG -3'
(R):5'- TGTGCACTGGTTTCATGAGTAAC -3'

Sequencing Primer
(F):5'- GCATCCTAACTGGCAGTTTG -3'
(R):5'- ACTCGAATAGCGTCATAGTTCTCCAG -3'
Posted On2020-07-28