Incidental Mutation 'R8268:Olfr1352'
ID639548
Institutional Source Beutler Lab
Gene Symbol Olfr1352
Ensembl Gene ENSMUSG00000046493
Gene Nameolfactory receptor 1352
SynonymsMOR139-1, GA_x6K02T2QGN0-2828447-2827518
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R8268 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location78981050-78987903 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78983997 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 69 (V69E)
Ref Sequence ENSEMBL: ENSMUSP00000054355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058991] [ENSMUST00000203973]
Predicted Effect probably damaging
Transcript: ENSMUST00000058991
AA Change: V69E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054355
Gene: ENSMUSG00000046493
AA Change: V69E

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.7e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 305 9.1e-6 PFAM
Pfam:7tm_1 41 290 4.7e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203973
AA Change: V36E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144895
Gene: ENSMUSG00000046493
AA Change: V36E

DomainStartEndE-ValueType
Pfam:7tm_4 1 122 6.1e-25 PFAM
Pfam:7TM_GPCR_Srx 1 123 7.5e-5 PFAM
Pfam:7TM_GPCR_Srsx 2 123 4.5e-8 PFAM
Pfam:7tm_1 8 123 2.1e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,457,317 C396S probably benign Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Ciapin1 A G 8: 94,831,883 V67A probably benign Het
Col7a1 A G 9: 108,972,989 R2018G unknown Het
Dnah11 A T 12: 118,027,508 Y2374* probably null Het
Dnah7b G T 1: 46,356,576 M3879I probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Gm12258 A C 11: 58,854,258 probably null Het
Hpse A G 5: 100,699,041 L174S probably damaging Het
Hspa8 A G 9: 40,803,152 K248R probably damaging Het
Kcnt2 A C 1: 140,523,216 R744S probably damaging Het
Klhl32 G A 4: 24,800,843 probably benign Het
Mkrn3 A G 7: 62,418,522 L507P probably damaging Het
Myom2 T G 8: 15,129,157 F1330V probably damaging Het
Nr1d2 A G 14: 18,216,659 S170P probably damaging Het
Nt5dc1 T C 10: 34,310,411 D388G probably damaging Het
Olfr1121 C A 2: 87,371,988 A152E probably damaging Het
Olfr1240 T C 2: 89,439,436 N281S probably damaging Het
Olfr45 A G 7: 140,691,517 D204G probably damaging Het
Pigg T A 5: 108,338,643 S721T probably damaging Het
Prr5 T C 15: 84,702,991 L323P probably benign Het
Rapgef2 T A 3: 79,085,956 I742L probably benign Het
Rxrb A G 17: 34,035,776 S302G probably benign Het
Setd5 T G 6: 113,149,690 probably null Het
Sh3bgr A G 16: 96,224,474 T187A unknown Het
Sh3pxd2a C T 19: 47,267,594 R923H probably benign Het
Slc26a10 A G 10: 127,173,622 probably null Het
Slc9a1 T A 4: 133,370,623 V27E probably benign Het
Stard3nl A G 13: 19,376,459 S49P probably damaging Het
Stxbp2 G A 8: 3,632,234 V17I Het
Themis3 C T 17: 66,555,791 E391K probably benign Het
Tia1 A G 6: 86,428,014 probably benign Het
Tmem167 T C 13: 90,104,435 F70S probably damaging Het
Trpm6 C A 19: 18,873,861 Q1729K possibly damaging Het
Tsc2 A C 17: 24,600,010 L1285W probably benign Het
Uchl4 A T 9: 64,235,509 I91F probably damaging Het
Wdfy3 C T 5: 101,941,610 A573T probably damaging Het
Zc2hc1c C T 12: 85,289,821 S84F probably benign Het
Zfp143 A G 7: 110,091,784 D515G probably benign Het
Other mutations in Olfr1352
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Olfr1352 APN 10 78983862 missense probably damaging 0.96
IGL01865:Olfr1352 APN 10 78984678 missense possibly damaging 0.94
R0196:Olfr1352 UTSW 10 78984189 missense possibly damaging 0.89
R0362:Olfr1352 UTSW 10 78984386 missense probably benign 0.00
R1574:Olfr1352 UTSW 10 78983986 missense probably damaging 1.00
R1574:Olfr1352 UTSW 10 78983986 missense probably damaging 1.00
R2982:Olfr1352 UTSW 10 78984440 missense probably damaging 1.00
R4724:Olfr1352 UTSW 10 78984522 missense probably damaging 1.00
R5000:Olfr1352 UTSW 10 78984680 missense probably benign 0.00
R5085:Olfr1352 UTSW 10 78984094 missense probably benign 0.03
R5145:Olfr1352 UTSW 10 78984309 missense probably benign 0.35
R5455:Olfr1352 UTSW 10 78984537 missense possibly damaging 0.59
R5777:Olfr1352 UTSW 10 78984678 missense possibly damaging 0.78
R5822:Olfr1352 UTSW 10 78984189 missense possibly damaging 0.89
R6283:Olfr1352 UTSW 10 78984279 missense probably benign 0.01
R7242:Olfr1352 UTSW 10 78984497 nonsense probably null
R7504:Olfr1352 UTSW 10 78984660 missense possibly damaging 0.78
R8198:Olfr1352 UTSW 10 78984609 missense probably benign 0.03
R8684:Olfr1352 UTSW 10 78984378 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TATACAGCACATGGAGCCAAG -3'
(R):5'- CCAGTATAATGCAGTGGATGGC -3'

Sequencing Primer
(F):5'- GCACATGGAGCCAAGAAACAATACTC -3'
(R):5'- GCAGATGGCCACATAACGGTC -3'
Posted On2020-07-28