Incidental Mutation 'R8268:Gm12258'
ID639550
Institutional Source Beutler Lab
Gene Symbol Gm12258
Ensembl Gene ENSMUSG00000072915
Gene Namepredicted gene 12258
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8268 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location58847158-58861956 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to C at 58854258 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000139337]
Predicted Effect probably null
Transcript: ENSMUST00000139337
SMART Domains Protein: ENSMUSP00000117644
Gene: ENSMUSG00000072915

DomainStartEndE-ValueType
KRAB 56 116 1.8e-32 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,457,317 C396S probably benign Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Ciapin1 A G 8: 94,831,883 V67A probably benign Het
Col7a1 A G 9: 108,972,989 R2018G unknown Het
Dnah11 A T 12: 118,027,508 Y2374* probably null Het
Dnah7b G T 1: 46,356,576 M3879I probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Hpse A G 5: 100,699,041 L174S probably damaging Het
Hspa8 A G 9: 40,803,152 K248R probably damaging Het
Kcnt2 A C 1: 140,523,216 R744S probably damaging Het
Klhl32 G A 4: 24,800,843 probably benign Het
Mkrn3 A G 7: 62,418,522 L507P probably damaging Het
Myom2 T G 8: 15,129,157 F1330V probably damaging Het
Nr1d2 A G 14: 18,216,659 S170P probably damaging Het
Nt5dc1 T C 10: 34,310,411 D388G probably damaging Het
Olfr1121 C A 2: 87,371,988 A152E probably damaging Het
Olfr1240 T C 2: 89,439,436 N281S probably damaging Het
Olfr1352 T A 10: 78,983,997 V69E probably damaging Het
Olfr45 A G 7: 140,691,517 D204G probably damaging Het
Pigg T A 5: 108,338,643 S721T probably damaging Het
Prr5 T C 15: 84,702,991 L323P probably benign Het
Rapgef2 T A 3: 79,085,956 I742L probably benign Het
Rxrb A G 17: 34,035,776 S302G probably benign Het
Setd5 T G 6: 113,149,690 probably null Het
Sh3bgr A G 16: 96,224,474 T187A unknown Het
Sh3pxd2a C T 19: 47,267,594 R923H probably benign Het
Slc26a10 A G 10: 127,173,622 probably null Het
Slc9a1 T A 4: 133,370,623 V27E probably benign Het
Stard3nl A G 13: 19,376,459 S49P probably damaging Het
Stxbp2 G A 8: 3,632,234 V17I Het
Themis3 C T 17: 66,555,791 E391K probably benign Het
Tia1 A G 6: 86,428,014 probably benign Het
Tmem167 T C 13: 90,104,435 F70S probably damaging Het
Trpm6 C A 19: 18,873,861 Q1729K possibly damaging Het
Tsc2 A C 17: 24,600,010 L1285W probably benign Het
Uchl4 A T 9: 64,235,509 I91F probably damaging Het
Wdfy3 C T 5: 101,941,610 A573T probably damaging Het
Zc2hc1c C T 12: 85,289,821 S84F probably benign Het
Zfp143 A G 7: 110,091,784 D515G probably benign Het
Other mutations in Gm12258
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Gm12258 APN 11 58856070 missense probably benign
IGL01391:Gm12258 APN 11 58848694 missense probably benign 0.03
IGL03081:Gm12258 APN 11 58858259 missense probably benign 0.07
R1521:Gm12258 UTSW 11 58859555 missense probably damaging 1.00
R1653:Gm12258 UTSW 11 58858287 missense possibly damaging 0.68
R3895:Gm12258 UTSW 11 58858549 nonsense probably null
R4065:Gm12258 UTSW 11 58858526 missense probably benign 0.08
R4066:Gm12258 UTSW 11 58858526 missense probably benign 0.08
R4747:Gm12258 UTSW 11 58859596 missense probably damaging 1.00
R4803:Gm12258 UTSW 11 58859030 missense probably benign 0.06
R5554:Gm12258 UTSW 11 58858468 missense possibly damaging 0.92
R5896:Gm12258 UTSW 11 58859631 missense probably damaging 1.00
R5956:Gm12258 UTSW 11 58859459 missense probably benign 0.02
R6277:Gm12258 UTSW 11 58854287 missense probably damaging 1.00
R7166:Gm12258 UTSW 11 58858473 missense
R7728:Gm12258 UTSW 11 58859692 missense unknown
R8161:Gm12258 UTSW 11 58859312 missense unknown
R8491:Gm12258 UTSW 11 58854296 missense
R8878:Gm12258 UTSW 11 58859286 missense unknown
Z1186:Gm12258 UTSW 11 58858300 missense
Z1186:Gm12258 UTSW 11 58858436 missense
Z1186:Gm12258 UTSW 11 58858938 missense unknown
Z1186:Gm12258 UTSW 11 58858950 missense unknown
Z1186:Gm12258 UTSW 11 58859007 missense unknown
Z1186:Gm12258 UTSW 11 58859187 unclassified probably benign
Z1186:Gm12258 UTSW 11 58859188 unclassified probably benign
Z1186:Gm12258 UTSW 11 58859864 missense unknown
Z1187:Gm12258 UTSW 11 58858300 missense
Z1187:Gm12258 UTSW 11 58858436 missense
Z1187:Gm12258 UTSW 11 58858938 missense unknown
Z1187:Gm12258 UTSW 11 58858950 missense unknown
Z1187:Gm12258 UTSW 11 58859007 missense unknown
Z1187:Gm12258 UTSW 11 58859187 unclassified probably benign
Z1187:Gm12258 UTSW 11 58859188 unclassified probably benign
Z1187:Gm12258 UTSW 11 58859864 missense unknown
Z1188:Gm12258 UTSW 11 58858300 missense
Z1188:Gm12258 UTSW 11 58858436 missense
Z1188:Gm12258 UTSW 11 58858938 missense unknown
Z1188:Gm12258 UTSW 11 58858950 missense unknown
Z1188:Gm12258 UTSW 11 58859007 missense unknown
Z1188:Gm12258 UTSW 11 58859187 unclassified probably benign
Z1188:Gm12258 UTSW 11 58859188 unclassified probably benign
Z1188:Gm12258 UTSW 11 58859864 missense unknown
Z1189:Gm12258 UTSW 11 58858300 missense
Z1189:Gm12258 UTSW 11 58858436 missense
Z1189:Gm12258 UTSW 11 58858938 missense unknown
Z1189:Gm12258 UTSW 11 58858950 missense unknown
Z1189:Gm12258 UTSW 11 58859007 missense unknown
Z1189:Gm12258 UTSW 11 58859187 unclassified probably benign
Z1189:Gm12258 UTSW 11 58859188 unclassified probably benign
Z1189:Gm12258 UTSW 11 58859864 missense unknown
Z1190:Gm12258 UTSW 11 58858300 missense
Z1190:Gm12258 UTSW 11 58858436 missense
Z1190:Gm12258 UTSW 11 58858938 missense unknown
Z1190:Gm12258 UTSW 11 58858950 missense unknown
Z1190:Gm12258 UTSW 11 58859007 missense unknown
Z1190:Gm12258 UTSW 11 58859187 unclassified probably benign
Z1190:Gm12258 UTSW 11 58859188 unclassified probably benign
Z1190:Gm12258 UTSW 11 58859864 missense unknown
Z1191:Gm12258 UTSW 11 58858300 missense
Z1191:Gm12258 UTSW 11 58858436 missense
Z1191:Gm12258 UTSW 11 58858938 missense unknown
Z1191:Gm12258 UTSW 11 58858950 missense unknown
Z1191:Gm12258 UTSW 11 58859007 missense unknown
Z1191:Gm12258 UTSW 11 58859187 unclassified probably benign
Z1191:Gm12258 UTSW 11 58859188 unclassified probably benign
Z1191:Gm12258 UTSW 11 58859864 missense unknown
Z1192:Gm12258 UTSW 11 58858300 missense
Z1192:Gm12258 UTSW 11 58858436 missense
Z1192:Gm12258 UTSW 11 58858938 missense unknown
Z1192:Gm12258 UTSW 11 58858950 missense unknown
Z1192:Gm12258 UTSW 11 58859007 missense unknown
Z1192:Gm12258 UTSW 11 58859187 unclassified probably benign
Z1192:Gm12258 UTSW 11 58859188 unclassified probably benign
Z1192:Gm12258 UTSW 11 58859864 missense unknown
Predicted Primers PCR Primer
(F):5'- TCGGAGTCAGATGCATTTAAGTG -3'
(R):5'- AGAAGCGGCTCCTGTATTTG -3'

Sequencing Primer
(F):5'- TCAGATGCATTTAAGTGGGAAAC -3'
(R):5'- CGGCTCCTGTATTTGCCAAAAAGG -3'
Posted On2020-07-28