Incidental Mutation 'R8268:Nr1d2'
ID639555
Institutional Source Beutler Lab
Gene Symbol Nr1d2
Ensembl Gene ENSMUSG00000021775
Gene Namenuclear receptor subfamily 1, group D, member 2
SynonymsRev-erb beta, RVR
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8268 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location18204054-18239127 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18216659 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 170 (S170P)
Ref Sequence ENSEMBL: ENSMUSP00000088031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090543]
PDB Structure
[]
Predicted Effect probably damaging
Transcript: ENSMUST00000090543
AA Change: S170P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088031
Gene: ENSMUSG00000021775
AA Change: S170P

DomainStartEndE-ValueType
low complexity region 13 47 N/A INTRINSIC
ZnF_C4 100 172 4.2e-38 SMART
Blast:HOLI 185 241 2e-13 BLAST
HOLI 404 562 3.71e-39 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the nuclear hormone receptor family, specifically the NR1 subfamily of receptors. The encoded protein functions as a transcriptional repressor and may play a role in circadian rhythms and carbohydrate and lipid metabolism. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no gross abnormalities. Mice homozygous for a different knock-out allele display an increased anxiety-related response. A subset of mice homozygous for a third knock-out allele show neonatal lethality, atrioventricular septal defects (AVSDs) and related cardiovascular malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,457,317 C396S probably benign Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Ciapin1 A G 8: 94,831,883 V67A probably benign Het
Col7a1 A G 9: 108,972,989 R2018G unknown Het
Dnah11 A T 12: 118,027,508 Y2374* probably null Het
Dnah7b G T 1: 46,356,576 M3879I probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Gm12258 A C 11: 58,854,258 probably null Het
Hpse A G 5: 100,699,041 L174S probably damaging Het
Hspa8 A G 9: 40,803,152 K248R probably damaging Het
Kcnt2 A C 1: 140,523,216 R744S probably damaging Het
Klhl32 G A 4: 24,800,843 probably benign Het
Mkrn3 A G 7: 62,418,522 L507P probably damaging Het
Myom2 T G 8: 15,129,157 F1330V probably damaging Het
Nt5dc1 T C 10: 34,310,411 D388G probably damaging Het
Olfr1121 C A 2: 87,371,988 A152E probably damaging Het
Olfr1240 T C 2: 89,439,436 N281S probably damaging Het
Olfr1352 T A 10: 78,983,997 V69E probably damaging Het
Olfr45 A G 7: 140,691,517 D204G probably damaging Het
Pigg T A 5: 108,338,643 S721T probably damaging Het
Prr5 T C 15: 84,702,991 L323P probably benign Het
Rapgef2 T A 3: 79,085,956 I742L probably benign Het
Rxrb A G 17: 34,035,776 S302G probably benign Het
Setd5 T G 6: 113,149,690 probably null Het
Sh3bgr A G 16: 96,224,474 T187A unknown Het
Sh3pxd2a C T 19: 47,267,594 R923H probably benign Het
Slc26a10 A G 10: 127,173,622 probably null Het
Slc9a1 T A 4: 133,370,623 V27E probably benign Het
Stard3nl A G 13: 19,376,459 S49P probably damaging Het
Stxbp2 G A 8: 3,632,234 V17I Het
Themis3 C T 17: 66,555,791 E391K probably benign Het
Tmem167 T C 13: 90,104,435 F70S probably damaging Het
Trpm6 C A 19: 18,873,861 Q1729K possibly damaging Het
Tsc2 A C 17: 24,600,010 L1285W probably benign Het
Uchl4 A T 9: 64,235,509 I91F probably damaging Het
Wdfy3 C T 5: 101,941,610 A573T probably damaging Het
Zc2hc1c C T 12: 85,289,821 S84F probably benign Het
Zfp143 A G 7: 110,091,784 D515G probably benign Het
Other mutations in Nr1d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Nr1d2 APN 14 18215502 intron probably benign
IGL00897:Nr1d2 APN 14 18214993 missense probably benign 0.03
IGL02425:Nr1d2 APN 14 18222011 missense probably benign
IGL03039:Nr1d2 APN 14 18215184 missense probably benign 0.01
IGL03169:Nr1d2 APN 14 18216703 missense probably damaging 1.00
IGL03388:Nr1d2 APN 14 18215403 missense probably benign 0.02
R0173:Nr1d2 UTSW 14 18215502 intron probably benign
R0242:Nr1d2 UTSW 14 18211933 missense possibly damaging 0.80
R0242:Nr1d2 UTSW 14 18211933 missense possibly damaging 0.80
R0674:Nr1d2 UTSW 14 18215086 missense probably benign 0.00
R1240:Nr1d2 UTSW 14 18211891 missense probably benign 0.04
R3115:Nr1d2 UTSW 14 18215504 splice site probably null
R3738:Nr1d2 UTSW 14 18211804 missense possibly damaging 0.74
R4165:Nr1d2 UTSW 14 18215446 missense probably benign 0.05
R5319:Nr1d2 UTSW 14 18215197 missense probably benign 0.00
R5353:Nr1d2 UTSW 14 18222125 missense probably benign 0.05
R5384:Nr1d2 UTSW 14 18211922 missense probably benign 0.08
R5486:Nr1d2 UTSW 14 18206860 missense possibly damaging 0.65
R5827:Nr1d2 UTSW 14 18222248 missense possibly damaging 0.88
R7873:Nr1d2 UTSW 14 18216656 nonsense probably null
X0067:Nr1d2 UTSW 14 18211823 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- GCTGCCTCTGAGATAATAGTACTC -3'
(R):5'- AGGTCTAGCTCCACATATACTAGC -3'

Sequencing Primer
(F):5'- GCCTCTGAGATAATAGTACTCATTCC -3'
(R):5'- GCTCCACATATACTAGCTTGATATGG -3'
Posted On2020-07-28