Incidental Mutation 'R8268:Prr5'
ID639556
Institutional Source Beutler Lab
Gene Symbol Prr5
Ensembl Gene ENSMUSG00000036106
Gene Nameproline rich 5 (renal)
SynonymsC030017C09Rik, Protor-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R8268 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location84669620-84703673 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84702991 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 323 (L323P)
Ref Sequence ENSEMBL: ENSMUSP00000066396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065499] [ENSMUST00000171460]
Predicted Effect probably benign
Transcript: ENSMUST00000065499
AA Change: L323P

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000066396
Gene: ENSMUSG00000036106
AA Change: L323P

DomainStartEndE-ValueType
Pfam:HbrB 38 144 6.9e-17 PFAM
low complexity region 333 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171460
AA Change: L314P

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000127890
Gene: ENSMUSG00000036106
AA Change: L314P

DomainStartEndE-ValueType
Pfam:HbrB 27 159 1.3e-36 PFAM
low complexity region 324 335 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a proline-rich domain. This gene is located in a region of chromosome 22 reported to contain a tumor suppressor gene that may be involved in breast and colorectal tumorigenesis. The protein is a component of the mammalian target of rapamycin complex 2 (mTORC2), and it regulates platelet-derived growth factor (PDGF) receptor beta expression and PDGF signaling to Akt and S6K1. Alternative splicing and the use of alternative promoters results in transcripts encoding different isoforms. Read-through transcripts from this gene into the downstream Rho GTPase activating protein 8 (ARHGAP8) gene also exist, which led to the original description of PRR5 and ARHGAP8 being a single gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,457,317 C396S probably benign Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Ciapin1 A G 8: 94,831,883 V67A probably benign Het
Col7a1 A G 9: 108,972,989 R2018G unknown Het
Dnah11 A T 12: 118,027,508 Y2374* probably null Het
Dnah7b G T 1: 46,356,576 M3879I probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Gm12258 A C 11: 58,854,258 probably null Het
Hpse A G 5: 100,699,041 L174S probably damaging Het
Hspa8 A G 9: 40,803,152 K248R probably damaging Het
Kcnt2 A C 1: 140,523,216 R744S probably damaging Het
Klhl32 G A 4: 24,800,843 probably benign Het
Mkrn3 A G 7: 62,418,522 L507P probably damaging Het
Myom2 T G 8: 15,129,157 F1330V probably damaging Het
Nr1d2 A G 14: 18,216,659 S170P probably damaging Het
Nt5dc1 T C 10: 34,310,411 D388G probably damaging Het
Olfr1121 C A 2: 87,371,988 A152E probably damaging Het
Olfr1240 T C 2: 89,439,436 N281S probably damaging Het
Olfr1352 T A 10: 78,983,997 V69E probably damaging Het
Olfr45 A G 7: 140,691,517 D204G probably damaging Het
Pigg T A 5: 108,338,643 S721T probably damaging Het
Rapgef2 T A 3: 79,085,956 I742L probably benign Het
Rxrb A G 17: 34,035,776 S302G probably benign Het
Setd5 T G 6: 113,149,690 probably null Het
Sh3bgr A G 16: 96,224,474 T187A unknown Het
Sh3pxd2a C T 19: 47,267,594 R923H probably benign Het
Slc26a10 A G 10: 127,173,622 probably null Het
Slc9a1 T A 4: 133,370,623 V27E probably benign Het
Stard3nl A G 13: 19,376,459 S49P probably damaging Het
Stxbp2 G A 8: 3,632,234 V17I Het
Themis3 C T 17: 66,555,791 E391K probably benign Het
Tia1 A G 6: 86,428,014 probably benign Het
Tmem167 T C 13: 90,104,435 F70S probably damaging Het
Trpm6 C A 19: 18,873,861 Q1729K possibly damaging Het
Tsc2 A C 17: 24,600,010 L1285W probably benign Het
Uchl4 A T 9: 64,235,509 I91F probably damaging Het
Wdfy3 C T 5: 101,941,610 A573T probably damaging Het
Zc2hc1c C T 12: 85,289,821 S84F probably benign Het
Zfp143 A G 7: 110,091,784 D515G probably benign Het
Other mutations in Prr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Prr5 APN 15 84699655 missense possibly damaging 0.47
IGL02656:Prr5 APN 15 84699136 missense probably damaging 1.00
R0234:Prr5 UTSW 15 84703121 missense probably damaging 1.00
R0234:Prr5 UTSW 15 84703121 missense probably damaging 1.00
R0389:Prr5 UTSW 15 84702951 missense probably benign 0.00
R0514:Prr5 UTSW 15 84702766 missense probably benign 0.19
R1414:Prr5 UTSW 15 84699711 nonsense probably null
R2027:Prr5 UTSW 15 84701379 missense probably damaging 0.99
R2230:Prr5 UTSW 15 84702780 missense probably benign 0.15
R2231:Prr5 UTSW 15 84702780 missense probably benign 0.15
R2232:Prr5 UTSW 15 84702780 missense probably benign 0.15
R3498:Prr5 UTSW 15 84703144 missense probably benign 0.12
R3791:Prr5 UTSW 15 84681216 missense probably damaging 1.00
R3910:Prr5 UTSW 15 84703144 missense probably benign 0.12
R5514:Prr5 UTSW 15 84702895 missense probably benign 0.01
R5911:Prr5 UTSW 15 84701434 nonsense probably null
R6085:Prr5 UTSW 15 84687905 missense probably damaging 1.00
R6187:Prr5 UTSW 15 84693772 missense probably damaging 1.00
R6394:Prr5 UTSW 15 84699724 missense probably damaging 0.99
R6422:Prr5 UTSW 15 84693804 missense probably damaging 1.00
R6631:Prr5 UTSW 15 84702777 missense probably damaging 0.99
R8113:Prr5 UTSW 15 84693792 missense probably damaging 1.00
R8328:Prr5 UTSW 15 84703186 makesense probably null
Predicted Primers PCR Primer
(F):5'- TCCTAGCCAAGAACCCAGTG -3'
(R):5'- GGTGCCTCAAAGTCAGACAC -3'

Sequencing Primer
(F):5'- ATCCTGTGGCCGAGCATGAAG -3'
(R):5'- GACACACTGGAGCGACTTC -3'
Posted On2020-07-28