Incidental Mutation 'R8268:Sh3bgr'
ID639557
Institutional Source Beutler Lab
Gene Symbol Sh3bgr
Ensembl Gene ENSMUSG00000040666
Gene NameSH3-binding domain glutamic acid-rich protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R8268 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location96200470-96228933 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96224474 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 187 (T187A)
Ref Sequence ENSEMBL: ENSMUSP00000038110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048770] [ENSMUST00000129904] [ENSMUST00000145069] [ENSMUST00000166952] [ENSMUST00000171181]
Predicted Effect unknown
Transcript: ENSMUST00000048770
AA Change: T187A
SMART Domains Protein: ENSMUSP00000038110
Gene: ENSMUSG00000040666
AA Change: T187A

DomainStartEndE-ValueType
Pfam:SH3BGR 1 98 1.9e-49 PFAM
low complexity region 120 138 N/A INTRINSIC
low complexity region 160 212 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123728
SMART Domains Protein: ENSMUSP00000116232
Gene: ENSMUSG00000040666

DomainStartEndE-ValueType
Pfam:SH3BGR 1 98 4.7e-50 PFAM
Pfam:Glutaredoxin 21 76 6.2e-7 PFAM
low complexity region 107 128 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129904
SMART Domains Protein: ENSMUSP00000116740
Gene: ENSMUSG00000040666

DomainStartEndE-ValueType
Pfam:SH3BGR 30 119 8.2e-43 PFAM
low complexity region 141 159 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000120614
Gene: ENSMUSG00000040666
AA Change: T123A

DomainStartEndE-ValueType
Pfam:SH3BGR 1 90 7.2e-45 PFAM
Pfam:Glutaredoxin 13 68 4.8e-7 PFAM
low complexity region 97 149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145069
Predicted Effect
SMART Domains Protein: ENSMUSP00000116607
Gene: ENSMUSG00000040666
AA Change: T67A

DomainStartEndE-ValueType
low complexity region 41 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166952
SMART Domains Protein: ENSMUSP00000129010
Gene: ENSMUSG00000040666

DomainStartEndE-ValueType
Pfam:SH3BGR 1 98 1.9e-50 PFAM
Pfam:Glutaredoxin 21 76 8.7e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000171181
AA Change: T187A
SMART Domains Protein: ENSMUSP00000126581
Gene: ENSMUSG00000040666
AA Change: T187A

DomainStartEndE-ValueType
Pfam:SH3BGR 1 98 1.9e-49 PFAM
low complexity region 120 138 N/A INTRINSIC
low complexity region 160 212 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,457,317 C396S probably benign Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Ciapin1 A G 8: 94,831,883 V67A probably benign Het
Col7a1 A G 9: 108,972,989 R2018G unknown Het
Dnah11 A T 12: 118,027,508 Y2374* probably null Het
Dnah7b G T 1: 46,356,576 M3879I probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Gm12258 A C 11: 58,854,258 probably null Het
Hpse A G 5: 100,699,041 L174S probably damaging Het
Hspa8 A G 9: 40,803,152 K248R probably damaging Het
Kcnt2 A C 1: 140,523,216 R744S probably damaging Het
Klhl32 G A 4: 24,800,843 probably benign Het
Mkrn3 A G 7: 62,418,522 L507P probably damaging Het
Myom2 T G 8: 15,129,157 F1330V probably damaging Het
Nr1d2 A G 14: 18,216,659 S170P probably damaging Het
Nt5dc1 T C 10: 34,310,411 D388G probably damaging Het
Olfr1121 C A 2: 87,371,988 A152E probably damaging Het
Olfr1240 T C 2: 89,439,436 N281S probably damaging Het
Olfr1352 T A 10: 78,983,997 V69E probably damaging Het
Olfr45 A G 7: 140,691,517 D204G probably damaging Het
Pigg T A 5: 108,338,643 S721T probably damaging Het
Prr5 T C 15: 84,702,991 L323P probably benign Het
Rapgef2 T A 3: 79,085,956 I742L probably benign Het
Rxrb A G 17: 34,035,776 S302G probably benign Het
Setd5 T G 6: 113,149,690 probably null Het
Sh3pxd2a C T 19: 47,267,594 R923H probably benign Het
Slc26a10 A G 10: 127,173,622 probably null Het
Slc9a1 T A 4: 133,370,623 V27E probably benign Het
Stard3nl A G 13: 19,376,459 S49P probably damaging Het
Stxbp2 G A 8: 3,632,234 V17I Het
Themis3 C T 17: 66,555,791 E391K probably benign Het
Tia1 A G 6: 86,428,014 probably benign Het
Tmem167 T C 13: 90,104,435 F70S probably damaging Het
Trpm6 C A 19: 18,873,861 Q1729K possibly damaging Het
Tsc2 A C 17: 24,600,010 L1285W probably benign Het
Uchl4 A T 9: 64,235,509 I91F probably damaging Het
Wdfy3 C T 5: 101,941,610 A573T probably damaging Het
Zc2hc1c C T 12: 85,289,821 S84F probably benign Het
Zfp143 A G 7: 110,091,784 D515G probably benign Het
Other mutations in Sh3bgr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Sh3bgr APN 16 96206490 missense probably damaging 1.00
IGL01404:Sh3bgr APN 16 96206490 missense probably damaging 1.00
R0201:Sh3bgr UTSW 16 96228517 unclassified probably benign
R5042:Sh3bgr UTSW 16 96205866 missense probably benign 0.01
R5203:Sh3bgr UTSW 16 96224520 unclassified probably benign
R5434:Sh3bgr UTSW 16 96224544 unclassified probably benign
R5441:Sh3bgr UTSW 16 96205917 missense possibly damaging 0.68
R6563:Sh3bgr UTSW 16 96205943 splice site probably null
R6869:Sh3bgr UTSW 16 96206660 missense probably damaging 1.00
R6873:Sh3bgr UTSW 16 96206491 missense probably damaging 1.00
R7260:Sh3bgr UTSW 16 96224481 missense unknown
R7373:Sh3bgr UTSW 16 96205835 missense unknown
R7382:Sh3bgr UTSW 16 96205893 missense probably benign 0.04
R7459:Sh3bgr UTSW 16 96205922 missense probably benign 0.02
R8241:Sh3bgr UTSW 16 96223870 missense unknown
R8396:Sh3bgr UTSW 16 96206480 critical splice acceptor site probably null
R8793:Sh3bgr UTSW 16 96224592 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGGTGACACTGGCGTAACT -3'
(R):5'- GTCACACAGGTCACACAGGA -3'

Sequencing Primer
(F):5'- ATATGTGTGTATGAGTGTTTGCATG -3'
(R):5'- GGTCACACAGGAGCTAGCACTC -3'
Posted On2020-07-28