Incidental Mutation 'R8268:Tsc2'
ID639558
Institutional Source Beutler Lab
Gene Symbol Tsc2
Ensembl Gene ENSMUSG00000002496
Gene Nametuberous sclerosis 2
Synonymstuberin, Nafld
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8268 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location24595816-24632630 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 24600010 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Tryptophan at position 1285 (L1285W)
Ref Sequence ENSEMBL: ENSMUSP00000094986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035565] [ENSMUST00000097373]
Predicted Effect probably benign
Transcript: ENSMUST00000035565
SMART Domains Protein: ENSMUSP00000049296
Gene: ENSMUSG00000032855

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LRRNT 32 71 1.61e-8 SMART
LRR_TYP 90 113 2.47e-5 SMART
LRRCT 125 177 3.84e-12 SMART
WSC 177 271 6.93e-34 SMART
PKD 272 355 2.72e-15 SMART
CLECT 406 530 5.72e-20 SMART
low complexity region 545 558 N/A INTRINSIC
low complexity region 763 788 N/A INTRINSIC
PKD 930 1008 1.06e-8 SMART
PKD 1015 1119 2.26e-12 SMART
PKD 1122 1205 2.03e-14 SMART
PKD 1208 1288 1.14e-17 SMART
PKD 1290 1373 2.35e-10 SMART
PKD 1374 1459 7.63e-10 SMART
PKD 1464 1541 1.95e-16 SMART
PKD 1544 1625 1.05e-16 SMART
PKD 1631 1714 1.93e-1 SMART
PKD 1716 1798 2.21e-15 SMART
PKD 1799 1882 5.7e-9 SMART
PKD 1884 1964 1.56e-6 SMART
PKD 1968 2056 3.1e-10 SMART
PKD 2057 2140 1.74e-13 SMART
Pfam:REJ 2167 2610 1e-108 PFAM
low complexity region 2697 2706 N/A INTRINSIC
GPS 3003 3052 1.33e-12 SMART
transmembrane domain 3065 3087 N/A INTRINSIC
LH2 3110 3224 3.5e-18 SMART
transmembrane domain 3275 3294 N/A INTRINSIC
transmembrane domain 3314 3336 N/A INTRINSIC
low complexity region 3357 3378 N/A INTRINSIC
low complexity region 3479 3492 N/A INTRINSIC
transmembrane domain 3547 3569 N/A INTRINSIC
low complexity region 3573 3591 N/A INTRINSIC
low complexity region 3626 3639 N/A INTRINSIC
low complexity region 3661 3676 N/A INTRINSIC
Pfam:PKD_channel 3701 4103 7.1e-125 PFAM
low complexity region 4153 4172 N/A INTRINSIC
low complexity region 4238 4256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097373
AA Change: L1285W

PolyPhen 2 Score 0.436 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000094986
Gene: ENSMUSG00000002496
AA Change: L1285W

DomainStartEndE-ValueType
Pfam:DUF3384 54 470 4e-103 PFAM
Pfam:Tuberin 555 903 5.9e-149 PFAM
low complexity region 1023 1054 N/A INTRINSIC
low complexity region 1271 1278 N/A INTRINSIC
low complexity region 1310 1328 N/A INTRINSIC
low complexity region 1330 1344 N/A INTRINSIC
low complexity region 1378 1398 N/A INTRINSIC
Pfam:Rap_GAP 1497 1685 1.3e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene lead to tuberous sclerosis complex. Its gene product is believed to be a tumor suppressor and is able to stimulate specific GTPases. The protein associates with hamartin in a cytosolic complex, possibly acting as a chaperone for hamartin. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit liver hypoplasia, open neural tube, thickened myocardium and die by embryonic day 9.5-12.5. Heterozygotes develop renal cystadenomas, liver hemangiomas (sometimes resulting in fatal bleeding) and lung adenomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,457,317 C396S probably benign Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Ciapin1 A G 8: 94,831,883 V67A probably benign Het
Col7a1 A G 9: 108,972,989 R2018G unknown Het
Dnah11 A T 12: 118,027,508 Y2374* probably null Het
Dnah7b G T 1: 46,356,576 M3879I probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Gm12258 A C 11: 58,854,258 probably null Het
Hpse A G 5: 100,699,041 L174S probably damaging Het
Hspa8 A G 9: 40,803,152 K248R probably damaging Het
Kcnt2 A C 1: 140,523,216 R744S probably damaging Het
Klhl32 G A 4: 24,800,843 probably benign Het
Mkrn3 A G 7: 62,418,522 L507P probably damaging Het
Myom2 T G 8: 15,129,157 F1330V probably damaging Het
Nr1d2 A G 14: 18,216,659 S170P probably damaging Het
Nt5dc1 T C 10: 34,310,411 D388G probably damaging Het
Olfr1121 C A 2: 87,371,988 A152E probably damaging Het
Olfr1240 T C 2: 89,439,436 N281S probably damaging Het
Olfr1352 T A 10: 78,983,997 V69E probably damaging Het
Olfr45 A G 7: 140,691,517 D204G probably damaging Het
Pigg T A 5: 108,338,643 S721T probably damaging Het
Prr5 T C 15: 84,702,991 L323P probably benign Het
Rapgef2 T A 3: 79,085,956 I742L probably benign Het
Rxrb A G 17: 34,035,776 S302G probably benign Het
Setd5 T G 6: 113,149,690 probably null Het
Sh3bgr A G 16: 96,224,474 T187A unknown Het
Sh3pxd2a C T 19: 47,267,594 R923H probably benign Het
Slc26a10 A G 10: 127,173,622 probably null Het
Slc9a1 T A 4: 133,370,623 V27E probably benign Het
Stard3nl A G 13: 19,376,459 S49P probably damaging Het
Stxbp2 G A 8: 3,632,234 V17I Het
Themis3 C T 17: 66,555,791 E391K probably benign Het
Tia1 A G 6: 86,428,014 probably benign Het
Tmem167 T C 13: 90,104,435 F70S probably damaging Het
Trpm6 C A 19: 18,873,861 Q1729K possibly damaging Het
Uchl4 A T 9: 64,235,509 I91F probably damaging Het
Wdfy3 C T 5: 101,941,610 A573T probably damaging Het
Zc2hc1c C T 12: 85,289,821 S84F probably benign Het
Zfp143 A G 7: 110,091,784 D515G probably benign Het
Other mutations in Tsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Tsc2 APN 17 24608107 missense probably damaging 1.00
IGL00985:Tsc2 APN 17 24597131 missense probably damaging 1.00
IGL01386:Tsc2 APN 17 24613285 missense probably damaging 1.00
IGL01468:Tsc2 APN 17 24621097 missense possibly damaging 0.90
IGL01530:Tsc2 APN 17 24622662 missense possibly damaging 0.76
IGL02390:Tsc2 APN 17 24600453 missense probably damaging 1.00
IGL02398:Tsc2 APN 17 24621729 missense probably damaging 1.00
IGL02741:Tsc2 APN 17 24629969 missense probably damaging 1.00
IGL03191:Tsc2 APN 17 24628054 missense probably damaging 1.00
IGL03372:Tsc2 APN 17 24619470 missense probably damaging 1.00
IGL03412:Tsc2 APN 17 24597068 missense probably damaging 0.98
Twitch UTSW 17 24596742 splice site probably null
PIT4515001:Tsc2 UTSW 17 24621147 missense probably benign 0.15
R0025:Tsc2 UTSW 17 24631004 splice site probably benign
R0025:Tsc2 UTSW 17 24631004 splice site probably benign
R0138:Tsc2 UTSW 17 24599626 missense possibly damaging 0.65
R0540:Tsc2 UTSW 17 24621712 missense probably damaging 1.00
R0570:Tsc2 UTSW 17 24626727 missense probably damaging 1.00
R0607:Tsc2 UTSW 17 24621712 missense probably damaging 1.00
R0826:Tsc2 UTSW 17 24596958 missense probably benign 0.04
R1430:Tsc2 UTSW 17 24599023 critical splice donor site probably null
R1440:Tsc2 UTSW 17 24614392 missense probably damaging 1.00
R1466:Tsc2 UTSW 17 24608973 missense probably damaging 1.00
R1466:Tsc2 UTSW 17 24608973 missense probably damaging 1.00
R1541:Tsc2 UTSW 17 24631976 missense probably damaging 1.00
R1717:Tsc2 UTSW 17 24597068 missense probably damaging 0.98
R1799:Tsc2 UTSW 17 24604408 missense probably benign
R2030:Tsc2 UTSW 17 24623470 splice site probably benign
R2147:Tsc2 UTSW 17 24621142 missense possibly damaging 0.62
R2888:Tsc2 UTSW 17 24631995 critical splice donor site probably null
R3609:Tsc2 UTSW 17 24622550 missense possibly damaging 0.74
R3610:Tsc2 UTSW 17 24622550 missense possibly damaging 0.74
R3811:Tsc2 UTSW 17 24629037 missense probably benign 0.09
R3895:Tsc2 UTSW 17 24599812 missense probably damaging 1.00
R3962:Tsc2 UTSW 17 24621166 splice site probably benign
R3971:Tsc2 UTSW 17 24623588 missense probably damaging 1.00
R4018:Tsc2 UTSW 17 24625281 missense probably damaging 0.99
R4184:Tsc2 UTSW 17 24632016 missense probably benign 0.43
R4435:Tsc2 UTSW 17 24599713 missense probably benign 0.01
R4437:Tsc2 UTSW 17 24599713 missense probably benign 0.01
R4474:Tsc2 UTSW 17 24597264 missense probably damaging 0.98
R4703:Tsc2 UTSW 17 24604909 missense probably benign 0.13
R4731:Tsc2 UTSW 17 24603275 missense possibly damaging 0.72
R4732:Tsc2 UTSW 17 24603275 missense possibly damaging 0.72
R4733:Tsc2 UTSW 17 24603275 missense possibly damaging 0.72
R4817:Tsc2 UTSW 17 24596742 splice site probably null
R4890:Tsc2 UTSW 17 24600035 missense probably damaging 1.00
R4922:Tsc2 UTSW 17 24600369 missense probably benign 0.22
R5119:Tsc2 UTSW 17 24603280 missense probably benign 0.00
R5393:Tsc2 UTSW 17 24600396 missense possibly damaging 0.89
R5785:Tsc2 UTSW 17 24599887 splice site probably null
R5838:Tsc2 UTSW 17 24613216 missense probably benign 0.01
R5857:Tsc2 UTSW 17 24600007 missense probably damaging 0.99
R5911:Tsc2 UTSW 17 24600387 missense possibly damaging 0.63
R5988:Tsc2 UTSW 17 24620766 missense probably damaging 1.00
R6275:Tsc2 UTSW 17 24600420 missense probably benign 0.00
R6290:Tsc2 UTSW 17 24596910 missense probably benign 0.04
R6371:Tsc2 UTSW 17 24626714 missense probably benign 0.00
R6467:Tsc2 UTSW 17 24609127 missense probably benign 0.04
R6577:Tsc2 UTSW 17 24610499 missense probably damaging 1.00
R6728:Tsc2 UTSW 17 24621124 missense probably damaging 1.00
R6918:Tsc2 UTSW 17 24613229 missense probably damaging 1.00
R6995:Tsc2 UTSW 17 24628054 missense probably damaging 1.00
R7026:Tsc2 UTSW 17 24626739 missense probably damaging 0.99
R7136:Tsc2 UTSW 17 24613280 missense probably benign 0.00
R7236:Tsc2 UTSW 17 24623594 missense possibly damaging 0.82
R7243:Tsc2 UTSW 17 24599630 missense probably benign 0.02
R7249:Tsc2 UTSW 17 24607755 missense probably damaging 1.00
R7450:Tsc2 UTSW 17 24600031 missense probably damaging 1.00
R7522:Tsc2 UTSW 17 24630965 missense probably damaging 1.00
R7529:Tsc2 UTSW 17 24597948 missense probably damaging 0.98
R7637:Tsc2 UTSW 17 24607492 missense probably benign 0.13
R7781:Tsc2 UTSW 17 24608115 missense possibly damaging 0.52
R8005:Tsc2 UTSW 17 24599596 missense probably damaging 0.98
R8262:Tsc2 UTSW 17 24614366 missense probably benign 0.06
R8400:Tsc2 UTSW 17 24604987 missense possibly damaging 0.62
Z1177:Tsc2 UTSW 17 24620779 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CAGCCGTCCAATATCAATCTTGTC -3'
(R):5'- TGTGAGCTGGATAGGCCTTC -3'

Sequencing Primer
(F):5'- TGTCCCCTAGGTCTCCAAGGATG -3'
(R):5'- CCCTCTATCTGGGTGGCATTTATTG -3'
Posted On2020-07-28