Incidental Mutation 'R8267:Col9a1'
ID 639565
Institutional Source Beutler Lab
Gene Symbol Col9a1
Ensembl Gene ENSMUSG00000026147
Gene Name collagen, type IX, alpha 1
Synonyms Col9a-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock # R8267 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 24177610-24252684 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24185186 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 150 (T150S)
Ref Sequence ENSEMBL: ENSMUSP00000051579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054588]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000054588
AA Change: T150S
SMART Domains Protein: ENSMUSP00000051579
Gene: ENSMUSG00000026147
AA Change: T150S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 50 244 5.73e-78 SMART
Pfam:Collagen 266 326 2e-11 PFAM
Pfam:Collagen 308 358 3.5e-9 PFAM
Pfam:Collagen 357 409 1.2e-8 PFAM
Pfam:Collagen 415 472 7.8e-11 PFAM
Pfam:Collagen 454 515 2.9e-11 PFAM
Pfam:Collagen 592 667 3.9e-8 PFAM
Pfam:Collagen 646 716 1.7e-9 PFAM
Pfam:Collagen 697 760 1.6e-10 PFAM
Pfam:Collagen 785 848 3.1e-11 PFAM
low complexity region 878 899 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, which is a minor (5-20%) collagen component of hyaline cartilage. Type IX collagen is usually found in tissues containing type II collagen, a fibrillar collagen. Studies in knockout mice have shown that synthesis of the alpha 1 chain is essential for assembly of type IX collagen molecules, a heterotrimeric molecule, and that lack of type IX collagen is associated with early onset osteoarthritis. Mutations in this gene are associated with osteoarthritis in humans, with multiple epiphyseal dysplasia, 6, a form of chondrodysplasia, and with Stickler syndrome, a disease characterized by ophthalmic, orofacial, articular, and auditory defects. Two transcript variants that encode different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation show no conspicuous skeletal abnormalities at birth but develop early-onset degenerative joint disease resembling osteoarthritis as well as progressive hearing loss; restoration and remodeling of trabecular bone is perturbed with minimal effects on cortical bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 CAT CATAAT 5: 24,576,591 probably benign Het
Acbd3 A G 1: 180,746,848 D379G probably damaging Het
Akp3 A T 1: 87,127,739 T503S unknown Het
Antxr2 T A 5: 97,965,762 probably null Het
Coro1c T C 5: 113,847,575 D287G probably damaging Het
Cox16 T C 12: 81,480,939 T45A probably benign Het
Cux1 A G 5: 136,282,999 L1161P probably damaging Het
Dock10 T C 1: 80,540,328 T1311A probably benign Het
Dopey1 C T 9: 86,514,001 P839S possibly damaging Het
Ehbp1 T A 11: 22,146,562 D334V probably benign Het
Gm11127 A G 17: 36,056,783 V221A possibly damaging Het
Gm35339 C T 15: 76,356,594 A494V Het
Hip1 A T 5: 135,428,613 Y720N probably benign Het
Hmcn1 A G 1: 150,859,254 F169S probably damaging Het
Hmcn2 A G 2: 31,459,179 T4977A probably benign Het
Kcnq5 A T 1: 21,505,385 I279N probably damaging Het
Lnx2 A T 5: 147,029,091 I406N probably damaging Het
Mdn1 T C 4: 32,742,485 Y3908H possibly damaging Het
Nme7 A G 1: 164,340,775 I128V probably benign Het
Olfr1281 A G 2: 111,328,815 Y132C probably benign Het
Olfr1511 A G 14: 52,390,446 F109S probably damaging Het
Optn T C 2: 5,054,651 T19A probably benign Het
Pmch A T 10: 88,091,117 probably benign Het
Rbms3 T C 9: 117,056,755 N141D possibly damaging Het
Reln A G 5: 22,004,112 L1156P probably damaging Het
Rgs6 A C 12: 82,651,895 M23L probably benign Het
Sh3tc1 T C 5: 35,706,407 Y812C probably benign Het
Smap1 T A 1: 23,866,284 K143I probably damaging Het
Thbs1 A T 2: 118,122,513 H868L probably damaging Het
Tnip3 T G 6: 65,605,842 V140G possibly damaging Het
Vmn2r100 T A 17: 19,522,490 C375* probably null Het
Vmn2r19 T C 6: 123,336,262 S764P possibly damaging Het
Vmn2r22 T C 6: 123,638,041 T197A possibly damaging Het
Vmn2r59 T G 7: 42,012,097 T765P probably damaging Het
Vmn2r71 A G 7: 85,615,496 K12R probably benign Het
Vps41 T C 13: 18,810,471 S163P probably benign Het
Zfp382 G C 7: 30,134,504 G527R probably damaging Het
Other mutations in Col9a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Col9a1 APN 1 24185225 missense unknown
IGL00517:Col9a1 APN 1 24195534 intron probably benign
IGL01125:Col9a1 APN 1 24224645 critical splice acceptor site probably null
IGL01505:Col9a1 APN 1 24185124 missense unknown
IGL01583:Col9a1 APN 1 24185144 missense unknown
IGL01627:Col9a1 APN 1 24179608 critical splice donor site probably null
IGL01773:Col9a1 APN 1 24205066 missense probably benign 0.17
IGL02117:Col9a1 APN 1 24237493 nonsense probably null
IGL02192:Col9a1 APN 1 24221987 missense probably damaging 1.00
IGL02346:Col9a1 APN 1 24223609 missense probably damaging 0.96
IGL02383:Col9a1 APN 1 24185258 missense unknown
IGL02453:Col9a1 APN 1 24179357 missense unknown
IGL02553:Col9a1 APN 1 24221937 splice site probably benign
IGL03412:Col9a1 APN 1 24210427 critical splice donor site probably null
IGL03493:Col9a1 APN 1 24221570 splice site probably benign
ANU74:Col9a1 UTSW 1 24185328 missense unknown
R0076:Col9a1 UTSW 1 24237497 critical splice donor site probably null
R0076:Col9a1 UTSW 1 24237497 critical splice donor site probably null
R0090:Col9a1 UTSW 1 24223562 splice site probably null
R0356:Col9a1 UTSW 1 24185247 nonsense probably null
R0562:Col9a1 UTSW 1 24179279 splice site probably null
R0584:Col9a1 UTSW 1 24224490 splice site probably benign
R0708:Col9a1 UTSW 1 24237261 missense possibly damaging 0.92
R1342:Col9a1 UTSW 1 24223620 critical splice donor site probably null
R1445:Col9a1 UTSW 1 24237498 critical splice donor site probably null
R1791:Col9a1 UTSW 1 24185305 missense unknown
R1938:Col9a1 UTSW 1 24222473 missense probably damaging 1.00
R2214:Col9a1 UTSW 1 24208202 missense probably damaging 1.00
R2240:Col9a1 UTSW 1 24179501 missense unknown
R3757:Col9a1 UTSW 1 24232231 critical splice donor site probably null
R3891:Col9a1 UTSW 1 24185436 critical splice donor site probably null
R4249:Col9a1 UTSW 1 24244381 missense probably damaging 1.00
R4690:Col9a1 UTSW 1 24224706 splice site probably null
R4918:Col9a1 UTSW 1 24237258 missense possibly damaging 0.74
R4988:Col9a1 UTSW 1 24185192 missense unknown
R5144:Col9a1 UTSW 1 24239353 missense probably benign 0.08
R5327:Col9a1 UTSW 1 24195539 critical splice donor site probably null
R5511:Col9a1 UTSW 1 24179538 missense unknown
R5519:Col9a1 UTSW 1 24230254 splice site probably null
R5564:Col9a1 UTSW 1 24195355 start gained probably benign
R6076:Col9a1 UTSW 1 24195376 start gained probably benign
R6478:Col9a1 UTSW 1 24185405 missense unknown
R6886:Col9a1 UTSW 1 24185345 missense unknown
R7177:Col9a1 UTSW 1 24195417 missense unknown
R7259:Col9a1 UTSW 1 24185343 missense unknown
R7268:Col9a1 UTSW 1 24207398 missense possibly damaging 0.89
R7347:Col9a1 UTSW 1 24179403 splice site probably null
R7644:Col9a1 UTSW 1 24185162 missense unknown
R7860:Col9a1 UTSW 1 24237180 missense probably damaging 1.00
R8296:Col9a1 UTSW 1 24178299 missense unknown
R8737:Col9a1 UTSW 1 24185046 missense unknown
R8773:Col9a1 UTSW 1 24185127 missense unknown
R8795:Col9a1 UTSW 1 24194731 missense unknown
R8878:Col9a1 UTSW 1 24196967 critical splice donor site probably null
R8956:Col9a1 UTSW 1 24237219 missense probably damaging 1.00
R8978:Col9a1 UTSW 1 24239315 missense probably damaging 1.00
R9096:Col9a1 UTSW 1 24185126 missense unknown
R9097:Col9a1 UTSW 1 24185126 missense unknown
R9205:Col9a1 UTSW 1 24185094 missense unknown
R9534:Col9a1 UTSW 1 24185169 missense unknown
Z1176:Col9a1 UTSW 1 24214588 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTGTAGCCTTTCCGCAG -3'
(R):5'- AAGCCATCCGCATCAATCTG -3'

Sequencing Primer
(F):5'- AGCACACACACAGAAAAATGG -3'
(R):5'- GCATCAATCTGGCCTCTTGG -3'
Posted On 2020-07-28