Incidental Mutation 'R8267:Col9a1'
ID 639565
Institutional Source Beutler Lab
Gene Symbol Col9a1
Ensembl Gene ENSMUSG00000026147
Gene Name collagen, type IX, alpha 1
Synonyms Col9a-1
MMRRC Submission 067651-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R8267 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 24216691-24291765 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24224267 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 150 (T150S)
Ref Sequence ENSEMBL: ENSMUSP00000051579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054588]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000054588
AA Change: T150S
SMART Domains Protein: ENSMUSP00000051579
Gene: ENSMUSG00000026147
AA Change: T150S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TSPN 50 244 5.73e-78 SMART
Pfam:Collagen 266 326 2e-11 PFAM
Pfam:Collagen 308 358 3.5e-9 PFAM
Pfam:Collagen 357 409 1.2e-8 PFAM
Pfam:Collagen 415 472 7.8e-11 PFAM
Pfam:Collagen 454 515 2.9e-11 PFAM
Pfam:Collagen 592 667 3.9e-8 PFAM
Pfam:Collagen 646 716 1.7e-9 PFAM
Pfam:Collagen 697 760 1.6e-10 PFAM
Pfam:Collagen 785 848 3.1e-11 PFAM
low complexity region 878 899 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, which is a minor (5-20%) collagen component of hyaline cartilage. Type IX collagen is usually found in tissues containing type II collagen, a fibrillar collagen. Studies in knockout mice have shown that synthesis of the alpha 1 chain is essential for assembly of type IX collagen molecules, a heterotrimeric molecule, and that lack of type IX collagen is associated with early onset osteoarthritis. Mutations in this gene are associated with osteoarthritis in humans, with multiple epiphyseal dysplasia, 6, a form of chondrodysplasia, and with Stickler syndrome, a disease characterized by ophthalmic, orofacial, articular, and auditory defects. Two transcript variants that encode different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation show no conspicuous skeletal abnormalities at birth but develop early-onset degenerative joint disease resembling osteoarthritis as well as progressive hearing loss; restoration and remodeling of trabecular bone is perturbed with minimal effects on cortical bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 CAT CATAAT 5: 24,781,589 (GRCm39) probably benign Het
Acbd3 A G 1: 180,574,413 (GRCm39) D379G probably damaging Het
Akp3 A T 1: 87,055,461 (GRCm39) T503S unknown Het
Antxr2 T A 5: 98,113,621 (GRCm39) probably null Het
Coro1c T C 5: 113,985,636 (GRCm39) D287G probably damaging Het
Cox16 T C 12: 81,527,713 (GRCm39) T45A probably benign Het
Cux1 A G 5: 136,311,853 (GRCm39) L1161P probably damaging Het
Dock10 T C 1: 80,518,045 (GRCm39) T1311A probably benign Het
Dop1a C T 9: 86,396,054 (GRCm39) P839S possibly damaging Het
Ehbp1 T A 11: 22,096,562 (GRCm39) D334V probably benign Het
H2-T15 A G 17: 36,367,675 (GRCm39) V221A possibly damaging Het
Hip1 A T 5: 135,457,467 (GRCm39) Y720N probably benign Het
Hmcn1 A G 1: 150,735,005 (GRCm39) F169S probably damaging Het
Hmcn2 A G 2: 31,349,191 (GRCm39) T4977A probably benign Het
Kcnq5 A T 1: 21,575,609 (GRCm39) I279N probably damaging Het
Lnx2 A T 5: 146,965,901 (GRCm39) I406N probably damaging Het
Mdn1 T C 4: 32,742,485 (GRCm39) Y3908H possibly damaging Het
Nme7 A G 1: 164,168,344 (GRCm39) I128V probably benign Het
Optn T C 2: 5,059,462 (GRCm39) T19A probably benign Het
Or10g1b A G 14: 52,627,903 (GRCm39) F109S probably damaging Het
Or4k37 A G 2: 111,159,160 (GRCm39) Y132C probably benign Het
Pmch A T 10: 87,926,979 (GRCm39) probably benign Het
Rbms3 T C 9: 116,885,823 (GRCm39) N141D possibly damaging Het
Reln A G 5: 22,209,110 (GRCm39) L1156P probably damaging Het
Rgs6 A C 12: 82,698,669 (GRCm39) M23L probably benign Het
Sh3tc1 T C 5: 35,863,751 (GRCm39) Y812C probably benign Het
Smap1 T A 1: 23,905,365 (GRCm39) K143I probably damaging Het
Thbs1 A T 2: 117,952,994 (GRCm39) H868L probably damaging Het
Tnip3 T G 6: 65,582,826 (GRCm39) V140G possibly damaging Het
Vmn2r100 T A 17: 19,742,752 (GRCm39) C375* probably null Het
Vmn2r19 T C 6: 123,313,221 (GRCm39) S764P possibly damaging Het
Vmn2r22 T C 6: 123,615,000 (GRCm39) T197A possibly damaging Het
Vmn2r59 T G 7: 41,661,521 (GRCm39) T765P probably damaging Het
Vmn2r71 A G 7: 85,264,704 (GRCm39) K12R probably benign Het
Vps41 T C 13: 18,994,641 (GRCm39) S163P probably benign Het
Wdr97 C T 15: 76,240,794 (GRCm39) A494V Het
Zfp382 G C 7: 29,833,929 (GRCm39) G527R probably damaging Het
Other mutations in Col9a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Col9a1 APN 1 24,224,306 (GRCm39) missense unknown
IGL00517:Col9a1 APN 1 24,234,615 (GRCm39) intron probably benign
IGL01125:Col9a1 APN 1 24,263,726 (GRCm39) critical splice acceptor site probably null
IGL01505:Col9a1 APN 1 24,224,205 (GRCm39) missense unknown
IGL01583:Col9a1 APN 1 24,224,225 (GRCm39) missense unknown
IGL01627:Col9a1 APN 1 24,218,689 (GRCm39) critical splice donor site probably null
IGL01773:Col9a1 APN 1 24,244,147 (GRCm39) missense probably benign 0.17
IGL02117:Col9a1 APN 1 24,276,574 (GRCm39) nonsense probably null
IGL02192:Col9a1 APN 1 24,261,068 (GRCm39) missense probably damaging 1.00
IGL02346:Col9a1 APN 1 24,262,690 (GRCm39) missense probably damaging 0.96
IGL02383:Col9a1 APN 1 24,224,339 (GRCm39) missense unknown
IGL02453:Col9a1 APN 1 24,218,438 (GRCm39) missense unknown
IGL02553:Col9a1 APN 1 24,261,018 (GRCm39) splice site probably benign
IGL03412:Col9a1 APN 1 24,249,508 (GRCm39) critical splice donor site probably null
IGL03493:Col9a1 APN 1 24,260,651 (GRCm39) splice site probably benign
ANU74:Col9a1 UTSW 1 24,224,409 (GRCm39) missense unknown
R0076:Col9a1 UTSW 1 24,276,578 (GRCm39) critical splice donor site probably null
R0076:Col9a1 UTSW 1 24,276,578 (GRCm39) critical splice donor site probably null
R0090:Col9a1 UTSW 1 24,262,643 (GRCm39) splice site probably null
R0356:Col9a1 UTSW 1 24,224,328 (GRCm39) nonsense probably null
R0562:Col9a1 UTSW 1 24,218,360 (GRCm39) splice site probably null
R0584:Col9a1 UTSW 1 24,263,571 (GRCm39) splice site probably benign
R0708:Col9a1 UTSW 1 24,276,342 (GRCm39) missense possibly damaging 0.92
R1342:Col9a1 UTSW 1 24,262,701 (GRCm39) critical splice donor site probably null
R1445:Col9a1 UTSW 1 24,276,579 (GRCm39) critical splice donor site probably null
R1791:Col9a1 UTSW 1 24,224,386 (GRCm39) missense unknown
R1938:Col9a1 UTSW 1 24,261,554 (GRCm39) missense probably damaging 1.00
R2214:Col9a1 UTSW 1 24,247,283 (GRCm39) missense probably damaging 1.00
R2240:Col9a1 UTSW 1 24,218,582 (GRCm39) missense unknown
R3757:Col9a1 UTSW 1 24,271,312 (GRCm39) critical splice donor site probably null
R3891:Col9a1 UTSW 1 24,224,517 (GRCm39) critical splice donor site probably null
R4249:Col9a1 UTSW 1 24,283,462 (GRCm39) missense probably damaging 1.00
R4690:Col9a1 UTSW 1 24,263,787 (GRCm39) splice site probably null
R4918:Col9a1 UTSW 1 24,276,339 (GRCm39) missense possibly damaging 0.74
R4988:Col9a1 UTSW 1 24,224,273 (GRCm39) missense unknown
R5144:Col9a1 UTSW 1 24,278,434 (GRCm39) missense probably benign 0.08
R5327:Col9a1 UTSW 1 24,234,620 (GRCm39) critical splice donor site probably null
R5511:Col9a1 UTSW 1 24,218,619 (GRCm39) missense unknown
R5519:Col9a1 UTSW 1 24,269,335 (GRCm39) splice site probably null
R5564:Col9a1 UTSW 1 24,234,436 (GRCm39) start gained probably benign
R6076:Col9a1 UTSW 1 24,234,457 (GRCm39) start gained probably benign
R6478:Col9a1 UTSW 1 24,224,486 (GRCm39) missense unknown
R6886:Col9a1 UTSW 1 24,224,426 (GRCm39) missense unknown
R7177:Col9a1 UTSW 1 24,234,498 (GRCm39) missense unknown
R7259:Col9a1 UTSW 1 24,224,424 (GRCm39) missense unknown
R7268:Col9a1 UTSW 1 24,246,479 (GRCm39) missense possibly damaging 0.89
R7347:Col9a1 UTSW 1 24,218,484 (GRCm39) splice site probably null
R7644:Col9a1 UTSW 1 24,224,243 (GRCm39) missense unknown
R7860:Col9a1 UTSW 1 24,276,261 (GRCm39) missense probably damaging 1.00
R8296:Col9a1 UTSW 1 24,217,380 (GRCm39) missense unknown
R8737:Col9a1 UTSW 1 24,224,127 (GRCm39) missense unknown
R8773:Col9a1 UTSW 1 24,224,208 (GRCm39) missense unknown
R8795:Col9a1 UTSW 1 24,233,812 (GRCm39) missense unknown
R8878:Col9a1 UTSW 1 24,236,048 (GRCm39) critical splice donor site probably null
R8956:Col9a1 UTSW 1 24,276,300 (GRCm39) missense probably damaging 1.00
R8978:Col9a1 UTSW 1 24,278,396 (GRCm39) missense probably damaging 1.00
R9096:Col9a1 UTSW 1 24,224,207 (GRCm39) missense unknown
R9097:Col9a1 UTSW 1 24,224,207 (GRCm39) missense unknown
R9205:Col9a1 UTSW 1 24,224,175 (GRCm39) missense unknown
R9534:Col9a1 UTSW 1 24,224,250 (GRCm39) missense unknown
Z1176:Col9a1 UTSW 1 24,253,669 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTGTAGCCTTTCCGCAG -3'
(R):5'- AAGCCATCCGCATCAATCTG -3'

Sequencing Primer
(F):5'- AGCACACACACAGAAAAATGG -3'
(R):5'- GCATCAATCTGGCCTCTTGG -3'
Posted On 2020-07-28