Incidental Mutation 'R8267:Akp3'
ID 639567
Institutional Source Beutler Lab
Gene Symbol Akp3
Ensembl Gene ENSMUSG00000036500
Gene Name alkaline phosphatase 3, intestine, not Mn requiring
Synonyms Akp-3, IAP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock # R8267 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 87124973-87127912 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 87127739 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 503 (T503S)
Ref Sequence ENSEMBL: ENSMUSP00000037497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044878]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000044878
AA Change: T503S
SMART Domains Protein: ENSMUSP00000037497
Gene: ENSMUSG00000036500
AA Change: T503S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 33 45 N/A INTRINSIC
alkPPc 53 487 1.92e-249 SMART
low complexity region 503 524 N/A INTRINSIC
low complexity region 533 557 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The intestinal alkaline phosphatase gene encodes a digestive brush-border enzyme. This enzyme is a component of the gut mucosal defense system and is thought to function in the detoxification of lipopolysaccharide, and in the prevention of bacterial translocation in the gut. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruption of this gene show no gross abnormalities in appearance, behavior or fertility. They do display accelerated lipid absorption on a high fat diet leading to elevated plasma triglycerides and increased weight gain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 CAT CATAAT 5: 24,576,591 probably benign Het
Acbd3 A G 1: 180,746,848 D379G probably damaging Het
Antxr2 T A 5: 97,965,762 probably null Het
Col9a1 A T 1: 24,185,186 T150S unknown Het
Coro1c T C 5: 113,847,575 D287G probably damaging Het
Cox16 T C 12: 81,480,939 T45A probably benign Het
Cux1 A G 5: 136,282,999 L1161P probably damaging Het
Dock10 T C 1: 80,540,328 T1311A probably benign Het
Dopey1 C T 9: 86,514,001 P839S possibly damaging Het
Ehbp1 T A 11: 22,146,562 D334V probably benign Het
Gm11127 A G 17: 36,056,783 V221A possibly damaging Het
Gm35339 C T 15: 76,356,594 A494V Het
Hip1 A T 5: 135,428,613 Y720N probably benign Het
Hmcn1 A G 1: 150,859,254 F169S probably damaging Het
Hmcn2 A G 2: 31,459,179 T4977A probably benign Het
Kcnq5 A T 1: 21,505,385 I279N probably damaging Het
Lnx2 A T 5: 147,029,091 I406N probably damaging Het
Mdn1 T C 4: 32,742,485 Y3908H possibly damaging Het
Nme7 A G 1: 164,340,775 I128V probably benign Het
Olfr1281 A G 2: 111,328,815 Y132C probably benign Het
Olfr1511 A G 14: 52,390,446 F109S probably damaging Het
Optn T C 2: 5,054,651 T19A probably benign Het
Pmch A T 10: 88,091,117 probably benign Het
Rbms3 T C 9: 117,056,755 N141D possibly damaging Het
Reln A G 5: 22,004,112 L1156P probably damaging Het
Rgs6 A C 12: 82,651,895 M23L probably benign Het
Sh3tc1 T C 5: 35,706,407 Y812C probably benign Het
Smap1 T A 1: 23,866,284 K143I probably damaging Het
Thbs1 A T 2: 118,122,513 H868L probably damaging Het
Tnip3 T G 6: 65,605,842 V140G possibly damaging Het
Vmn2r100 T A 17: 19,522,490 C375* probably null Het
Vmn2r19 T C 6: 123,336,262 S764P possibly damaging Het
Vmn2r22 T C 6: 123,638,041 T197A possibly damaging Het
Vmn2r59 T G 7: 42,012,097 T765P probably damaging Het
Vmn2r71 A G 7: 85,615,496 K12R probably benign Het
Vps41 T C 13: 18,810,471 S163P probably benign Het
Zfp382 G C 7: 30,134,504 G527R probably damaging Het
Other mutations in Akp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Akp3 APN 1 87127136 splice site probably benign
IGL02146:Akp3 APN 1 87126575 missense probably benign 0.00
IGL02216:Akp3 APN 1 87127650 missense probably damaging 1.00
IGL02677:Akp3 APN 1 87125272 missense probably damaging 1.00
IGL02716:Akp3 APN 1 87125479 missense probably damaging 1.00
IGL02943:Akp3 APN 1 87126369 nonsense probably null
IGL03099:Akp3 APN 1 87127606 missense probably benign 0.14
R0458:Akp3 UTSW 1 87126537 nonsense probably null
R0755:Akp3 UTSW 1 87127871 missense unknown
R0783:Akp3 UTSW 1 87127871 missense unknown
R0784:Akp3 UTSW 1 87127871 missense unknown
R1080:Akp3 UTSW 1 87127001 missense probably damaging 0.99
R1120:Akp3 UTSW 1 87125437 missense probably damaging 0.98
R1128:Akp3 UTSW 1 87127871 missense unknown
R1130:Akp3 UTSW 1 87127871 missense unknown
R1175:Akp3 UTSW 1 87127871 missense unknown
R1200:Akp3 UTSW 1 87125260 missense probably damaging 1.00
R1618:Akp3 UTSW 1 87127871 missense unknown
R1864:Akp3 UTSW 1 87127767 small deletion probably benign
R2111:Akp3 UTSW 1 87126885 splice site probably null
R4657:Akp3 UTSW 1 87125834 intron probably benign
R5278:Akp3 UTSW 1 87125166 missense probably benign 0.01
R5563:Akp3 UTSW 1 87125924 missense probably damaging 1.00
R5643:Akp3 UTSW 1 87127763 missense unknown
R5768:Akp3 UTSW 1 87127122 missense probably damaging 0.99
R5809:Akp3 UTSW 1 87126548 missense probably benign 0.06
R5956:Akp3 UTSW 1 87126945 missense probably damaging 1.00
R5999:Akp3 UTSW 1 87127541 missense probably damaging 1.00
R6945:Akp3 UTSW 1 87125631 missense probably damaging 1.00
R7028:Akp3 UTSW 1 87126778 missense probably benign
R7154:Akp3 UTSW 1 87125224 missense probably damaging 0.99
R7162:Akp3 UTSW 1 87127749 missense unknown
R7486:Akp3 UTSW 1 87125479 missense probably damaging 1.00
R7825:Akp3 UTSW 1 87127767 small deletion probably benign
R8708:Akp3 UTSW 1 87126369 nonsense probably null
R9026:Akp3 UTSW 1 87127064 missense possibly damaging 0.89
R9433:Akp3 UTSW 1 87125795 missense probably benign 0.01
X0018:Akp3 UTSW 1 87126338 missense probably damaging 1.00
X0060:Akp3 UTSW 1 87125894 missense probably damaging 1.00
X0066:Akp3 UTSW 1 87126796 missense probably damaging 0.98
Z1177:Akp3 UTSW 1 87126445 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAACATCTTGTCCCTCCAGGTGG -3'
(R):5'- CCTAGATGTGCTGGAGTTTAGGAC -3'

Sequencing Primer
(F):5'- TCCAGGTGGCTCATCGTAC -3'
(R):5'- CCCCTAGTAGTAGCATCAG -3'
Posted On 2020-07-28